ID: 905352415

View in Genome Browser
Species Human (GRCh38)
Location 1:37356747-37356769
Sequence ATCAGTGGGACAAAAAACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905352404_905352415 17 Left 905352404 1:37356707-37356729 CCCCCAGCTGCTGCAGGTGAGGG No data
Right 905352415 1:37356747-37356769 ATCAGTGGGACAAAAAACTTGGG No data
905352402_905352415 18 Left 905352402 1:37356706-37356728 CCCCCCAGCTGCTGCAGGTGAGG No data
Right 905352415 1:37356747-37356769 ATCAGTGGGACAAAAAACTTGGG No data
905352408_905352415 14 Left 905352408 1:37356710-37356732 CCAGCTGCTGCAGGTGAGGGCCT No data
Right 905352415 1:37356747-37356769 ATCAGTGGGACAAAAAACTTGGG No data
905352400_905352415 26 Left 905352400 1:37356698-37356720 CCTCAGTGCCCCCCAGCTGCTGC No data
Right 905352415 1:37356747-37356769 ATCAGTGGGACAAAAAACTTGGG No data
905352406_905352415 16 Left 905352406 1:37356708-37356730 CCCCAGCTGCTGCAGGTGAGGGC No data
Right 905352415 1:37356747-37356769 ATCAGTGGGACAAAAAACTTGGG No data
905352407_905352415 15 Left 905352407 1:37356709-37356731 CCCAGCTGCTGCAGGTGAGGGCC No data
Right 905352415 1:37356747-37356769 ATCAGTGGGACAAAAAACTTGGG No data
905352409_905352415 -6 Left 905352409 1:37356730-37356752 CCTGTCACCATCAAGCCATCAGT No data
Right 905352415 1:37356747-37356769 ATCAGTGGGACAAAAAACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905352415 Original CRISPR ATCAGTGGGACAAAAAACTT GGG Intergenic
No off target data available for this crispr