ID: 905356599

View in Genome Browser
Species Human (GRCh38)
Location 1:37389187-37389209
Sequence AGGTCTGGATATGCACCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905356599_905356610 5 Left 905356599 1:37389187-37389209 CCAGAAGGTGCATATCCAGACCT No data
Right 905356610 1:37389215-37389237 CAACAGTGGGGCTGGCAGGTGGG No data
905356599_905356607 -3 Left 905356599 1:37389187-37389209 CCAGAAGGTGCATATCCAGACCT No data
Right 905356607 1:37389207-37389229 CCTGGTGGCAACAGTGGGGCTGG No data
905356599_905356612 9 Left 905356599 1:37389187-37389209 CCAGAAGGTGCATATCCAGACCT No data
Right 905356612 1:37389219-37389241 AGTGGGGCTGGCAGGTGGGGAGG No data
905356599_905356604 -8 Left 905356599 1:37389187-37389209 CCAGAAGGTGCATATCCAGACCT No data
Right 905356604 1:37389202-37389224 CCAGACCTGGTGGCAACAGTGGG No data
905356599_905356614 11 Left 905356599 1:37389187-37389209 CCAGAAGGTGCATATCCAGACCT No data
Right 905356614 1:37389221-37389243 TGGGGCTGGCAGGTGGGGAGGGG No data
905356599_905356609 4 Left 905356599 1:37389187-37389209 CCAGAAGGTGCATATCCAGACCT No data
Right 905356609 1:37389214-37389236 GCAACAGTGGGGCTGGCAGGTGG No data
905356599_905356611 6 Left 905356599 1:37389187-37389209 CCAGAAGGTGCATATCCAGACCT No data
Right 905356611 1:37389216-37389238 AACAGTGGGGCTGGCAGGTGGGG No data
905356599_905356613 10 Left 905356599 1:37389187-37389209 CCAGAAGGTGCATATCCAGACCT No data
Right 905356613 1:37389220-37389242 GTGGGGCTGGCAGGTGGGGAGGG No data
905356599_905356602 -9 Left 905356599 1:37389187-37389209 CCAGAAGGTGCATATCCAGACCT No data
Right 905356602 1:37389201-37389223 TCCAGACCTGGTGGCAACAGTGG No data
905356599_905356608 1 Left 905356599 1:37389187-37389209 CCAGAAGGTGCATATCCAGACCT No data
Right 905356608 1:37389211-37389233 GTGGCAACAGTGGGGCTGGCAGG No data
905356599_905356615 12 Left 905356599 1:37389187-37389209 CCAGAAGGTGCATATCCAGACCT No data
Right 905356615 1:37389222-37389244 GGGGCTGGCAGGTGGGGAGGGGG No data
905356599_905356605 -7 Left 905356599 1:37389187-37389209 CCAGAAGGTGCATATCCAGACCT No data
Right 905356605 1:37389203-37389225 CAGACCTGGTGGCAACAGTGGGG No data
905356599_905356616 22 Left 905356599 1:37389187-37389209 CCAGAAGGTGCATATCCAGACCT No data
Right 905356616 1:37389232-37389254 GGTGGGGAGGGGGCACAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905356599 Original CRISPR AGGTCTGGATATGCACCTTC TGG (reversed) Intergenic
No off target data available for this crispr