ID: 905357492

View in Genome Browser
Species Human (GRCh38)
Location 1:37394944-37394966
Sequence GAGAAAGCACAGAAGCAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905357489_905357492 13 Left 905357489 1:37394908-37394930 CCACACCACAGGGGCGGGGTCTG No data
Right 905357492 1:37394944-37394966 GAGAAAGCACAGAAGCAGCAAGG No data
905357491_905357492 8 Left 905357491 1:37394913-37394935 CCACAGGGGCGGGGTCTGGATTC No data
Right 905357492 1:37394944-37394966 GAGAAAGCACAGAAGCAGCAAGG No data
905357484_905357492 22 Left 905357484 1:37394899-37394921 CCAGCAGGTCCACACCACAGGGG No data
Right 905357492 1:37394944-37394966 GAGAAAGCACAGAAGCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905357492 Original CRISPR GAGAAAGCACAGAAGCAGCA AGG Intergenic
No off target data available for this crispr