ID: 905358283

View in Genome Browser
Species Human (GRCh38)
Location 1:37400332-37400354
Sequence AAATGATGGTAAGATCATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905358277_905358283 10 Left 905358277 1:37400299-37400321 CCGTGTGTATAACTGGGGTGAGT No data
Right 905358283 1:37400332-37400354 AAATGATGGTAAGATCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905358283 Original CRISPR AAATGATGGTAAGATCATGG AGG Intergenic
No off target data available for this crispr