ID: 905358359

View in Genome Browser
Species Human (GRCh38)
Location 1:37400761-37400783
Sequence GCCGCGTGCTATCCATCATC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905358358_905358359 18 Left 905358358 1:37400720-37400742 CCATTGGCAGGCATAAAAAGAAT No data
Right 905358359 1:37400761-37400783 GCCGCGTGCTATCCATCATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905358359 Original CRISPR GCCGCGTGCTATCCATCATC CGG Intergenic
No off target data available for this crispr