ID: 905359988

View in Genome Browser
Species Human (GRCh38)
Location 1:37412579-37412601
Sequence GCTCAGAACAGAGCACAAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905359988_905359998 22 Left 905359988 1:37412579-37412601 CCGGCTTGTGCTCTGTTCTGAGC No data
Right 905359998 1:37412624-37412646 AACTGGCTGGAATGTGGCTTTGG No data
905359988_905359991 5 Left 905359988 1:37412579-37412601 CCGGCTTGTGCTCTGTTCTGAGC No data
Right 905359991 1:37412607-37412629 CTGACCCCAGTTTGCCAAACTGG No data
905359988_905359996 16 Left 905359988 1:37412579-37412601 CCGGCTTGTGCTCTGTTCTGAGC No data
Right 905359996 1:37412618-37412640 TTGCCAAACTGGCTGGAATGTGG No data
905359988_905359999 28 Left 905359988 1:37412579-37412601 CCGGCTTGTGCTCTGTTCTGAGC No data
Right 905359999 1:37412630-37412652 CTGGAATGTGGCTTTGGACTAGG No data
905359988_905359993 9 Left 905359988 1:37412579-37412601 CCGGCTTGTGCTCTGTTCTGAGC No data
Right 905359993 1:37412611-37412633 CCCCAGTTTGCCAAACTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905359988 Original CRISPR GCTCAGAACAGAGCACAAGC CGG (reversed) Intergenic
No off target data available for this crispr