ID: 905361074

View in Genome Browser
Species Human (GRCh38)
Location 1:37420836-37420858
Sequence CTGTGGATACTGAGGGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905361074_905361079 -7 Left 905361074 1:37420836-37420858 CCATCATCCCTCAGTATCCACAG No data
Right 905361079 1:37420852-37420874 TCCACAGGGAGATTCGTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905361074 Original CRISPR CTGTGGATACTGAGGGATGA TGG (reversed) Intergenic
No off target data available for this crispr