ID: 905361873

View in Genome Browser
Species Human (GRCh38)
Location 1:37426361-37426383
Sequence TGTCATGGCAGTACTGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905361869_905361873 -10 Left 905361869 1:37426348-37426370 CCTGGTACCCCACTGTCATGGCA No data
Right 905361873 1:37426361-37426383 TGTCATGGCAGTACTGTGCATGG No data
905361863_905361873 4 Left 905361863 1:37426334-37426356 CCTTGCCCGATGCCCCTGGTACC No data
Right 905361873 1:37426361-37426383 TGTCATGGCAGTACTGTGCATGG No data
905361866_905361873 -8 Left 905361866 1:37426346-37426368 CCCCTGGTACCCCACTGTCATGG No data
Right 905361873 1:37426361-37426383 TGTCATGGCAGTACTGTGCATGG No data
905361860_905361873 18 Left 905361860 1:37426320-37426342 CCTGAGTTAGGAACCCTTGCCCG No data
Right 905361873 1:37426361-37426383 TGTCATGGCAGTACTGTGCATGG No data
905361859_905361873 24 Left 905361859 1:37426314-37426336 CCACAGCCTGAGTTAGGAACCCT No data
Right 905361873 1:37426361-37426383 TGTCATGGCAGTACTGTGCATGG No data
905361858_905361873 25 Left 905361858 1:37426313-37426335 CCCACAGCCTGAGTTAGGAACCC No data
Right 905361873 1:37426361-37426383 TGTCATGGCAGTACTGTGCATGG No data
905361865_905361873 -2 Left 905361865 1:37426340-37426362 CCGATGCCCCTGGTACCCCACTG No data
Right 905361873 1:37426361-37426383 TGTCATGGCAGTACTGTGCATGG No data
905361864_905361873 -1 Left 905361864 1:37426339-37426361 CCCGATGCCCCTGGTACCCCACT No data
Right 905361873 1:37426361-37426383 TGTCATGGCAGTACTGTGCATGG No data
905361868_905361873 -9 Left 905361868 1:37426347-37426369 CCCTGGTACCCCACTGTCATGGC No data
Right 905361873 1:37426361-37426383 TGTCATGGCAGTACTGTGCATGG No data
905361862_905361873 5 Left 905361862 1:37426333-37426355 CCCTTGCCCGATGCCCCTGGTAC No data
Right 905361873 1:37426361-37426383 TGTCATGGCAGTACTGTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905361873 Original CRISPR TGTCATGGCAGTACTGTGCA TGG Intergenic
No off target data available for this crispr