ID: 905363829

View in Genome Browser
Species Human (GRCh38)
Location 1:37438131-37438153
Sequence AAGGGTAGGGATTCGGGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905363829_905363841 26 Left 905363829 1:37438131-37438153 CCTCCACCCGAATCCCTACCCTT No data
Right 905363841 1:37438180-37438202 TGCACAACCTTGCTCCCTCTGGG No data
905363829_905363840 25 Left 905363829 1:37438131-37438153 CCTCCACCCGAATCCCTACCCTT No data
Right 905363840 1:37438179-37438201 TTGCACAACCTTGCTCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905363829 Original CRISPR AAGGGTAGGGATTCGGGTGG AGG (reversed) Intergenic
No off target data available for this crispr