ID: 905369198

View in Genome Browser
Species Human (GRCh38)
Location 1:37474394-37474416
Sequence GTCCGGCGCGCAGCGGCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 162}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905369187_905369198 -3 Left 905369187 1:37474374-37474396 CCGACCCCCGCTTGGGCCCCGTC 0: 1
1: 0
2: 0
3: 10
4: 149
Right 905369198 1:37474394-37474416 GTCCGGCGCGCAGCGGCCGCGGG 0: 1
1: 0
2: 1
3: 21
4: 162
905369183_905369198 13 Left 905369183 1:37474358-37474380 CCGCAGCCTTGAGGCTCCGACCC 0: 1
1: 0
2: 1
3: 15
4: 181
Right 905369198 1:37474394-37474416 GTCCGGCGCGCAGCGGCCGCGGG 0: 1
1: 0
2: 1
3: 21
4: 162
905369184_905369198 7 Left 905369184 1:37474364-37474386 CCTTGAGGCTCCGACCCCCGCTT 0: 1
1: 0
2: 0
3: 3
4: 90
Right 905369198 1:37474394-37474416 GTCCGGCGCGCAGCGGCCGCGGG 0: 1
1: 0
2: 1
3: 21
4: 162
905369190_905369198 -8 Left 905369190 1:37474379-37474401 CCCCGCTTGGGCCCCGTCCGGCG 0: 1
1: 0
2: 0
3: 2
4: 54
Right 905369198 1:37474394-37474416 GTCCGGCGCGCAGCGGCCGCGGG 0: 1
1: 0
2: 1
3: 21
4: 162
905369191_905369198 -9 Left 905369191 1:37474380-37474402 CCCGCTTGGGCCCCGTCCGGCGC 0: 1
1: 0
2: 0
3: 4
4: 96
Right 905369198 1:37474394-37474416 GTCCGGCGCGCAGCGGCCGCGGG 0: 1
1: 0
2: 1
3: 21
4: 162
905369189_905369198 -7 Left 905369189 1:37474378-37474400 CCCCCGCTTGGGCCCCGTCCGGC 0: 1
1: 0
2: 0
3: 5
4: 103
Right 905369198 1:37474394-37474416 GTCCGGCGCGCAGCGGCCGCGGG 0: 1
1: 0
2: 1
3: 21
4: 162
905369192_905369198 -10 Left 905369192 1:37474381-37474403 CCGCTTGGGCCCCGTCCGGCGCG 0: 1
1: 0
2: 0
3: 2
4: 57
Right 905369198 1:37474394-37474416 GTCCGGCGCGCAGCGGCCGCGGG 0: 1
1: 0
2: 1
3: 21
4: 162
905369182_905369198 16 Left 905369182 1:37474355-37474377 CCGCCGCAGCCTTGAGGCTCCGA 0: 1
1: 0
2: 0
3: 10
4: 86
Right 905369198 1:37474394-37474416 GTCCGGCGCGCAGCGGCCGCGGG 0: 1
1: 0
2: 1
3: 21
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905369198 Original CRISPR GTCCGGCGCGCAGCGGCCGC GGG Intergenic
900581644 1:3412585-3412607 ATCCGGCGAGGAGCAGCCGCTGG + Exonic
900786927 1:4655223-4655245 GGCCGGCGCGCCGCCGCCGTTGG - Exonic
901272289 1:7961753-7961775 GGCCGGGGCGCCGCGTCCGCAGG + Intronic
901540107 1:9910134-9910156 GTCCGGCGCGCAGCGCGCGGCGG + Exonic
901628920 1:10638863-10638885 GCCCCGCGCGAAGCGGCCCCTGG - Exonic
901836292 1:11926105-11926127 GTCCGGCGCGCGGCGGGCGGCGG - Exonic
902214168 1:14924219-14924241 GTCCGGCGCGCGCCGCCGGCCGG + Intronic
902385605 1:16073734-16073756 CTCCCGCGCGCTGCGGCCACAGG - Intergenic
903897769 1:26620359-26620381 GTCGGGGGCGCAGCTGCCGCCGG - Intergenic
904782989 1:32964536-32964558 GGCCCGGGCGCGGCGGCCGCGGG + Exonic
904941006 1:34164865-34164887 GTGGGGCGCGCGGCGGCCGCTGG + Intronic
905369198 1:37474394-37474416 GTCCGGCGCGCAGCGGCCGCGGG + Intergenic
908555697 1:65254689-65254711 GGCAGGGGCGCAGCGGCGGCGGG + Intronic
913250765 1:116910400-116910422 GCCCGGCGGGGAGCGGCCGCGGG + Intronic
915310835 1:155005113-155005135 GTGCGGCGGGCAGCGGGGGCTGG + Intronic
919892040 1:201982705-201982727 GCGCGGAGTGCAGCGGCCGCCGG - Exonic
1064086492 10:12349584-12349606 AGCCGGCGCGCGGCGGCGGCAGG + Exonic
1065099572 10:22320750-22320772 GGCCGGGGGGCGGCGGCCGCGGG + Intronic
1065188707 10:23192355-23192377 GGCCAGAGCGCAGCGGCCGCGGG + Exonic
1065214771 10:23439148-23439170 CTTCGGCCCGCGGCGGCCGCTGG - Intergenic
1068954015 10:62805473-62805495 GGGCGGCGGGCAACGGCCGCGGG + Exonic
1068955533 10:62816595-62816617 GTCCGGGGCGCAGGGATCGCGGG + Intronic
1069615065 10:69801729-69801751 GGCCGGCGGGCTGGGGCCGCCGG + Intergenic
1072207908 10:93221053-93221075 ATCAGGGGCGCAGAGGCCGCGGG + Intergenic
1073177783 10:101566830-101566852 GCCCTGCGCTCAGCGGCCGCAGG + Intergenic
1073290058 10:102409101-102409123 GGCCGGCGCGCCGCGGCCCCCGG + Intronic
1074586009 10:114768241-114768263 GGCGGGGACGCAGCGGCCGCAGG + Intergenic
1074618589 10:115093818-115093840 GGCCGGCGGGCGGCGGCGGCGGG + Exonic
1075031942 10:119029751-119029773 GTCCGGCCCGCGCCGGCGGCGGG + Exonic
1075754710 10:124801717-124801739 CTGCGGCGGGCAGCGGCCGAGGG - Intergenic
1077037976 11:504398-504420 GTCCCGGGCGGAGCGGGCGCGGG - Intronic
1077502177 11:2914393-2914415 GTCCGGCGTGCAGAGGCCCCAGG + Intronic
1077877276 11:6319402-6319424 ATCCGGTGCGCCGCAGCCGCTGG + Exonic
1081636752 11:44726951-44726973 GGCGGGCGTGCAGCTGCCGCCGG + Intronic
1084086426 11:66857269-66857291 GTCCGTCGCTCAGGGGGCGCGGG - Intronic
1084204405 11:67583671-67583693 GCCCGGGGTGCAGCGGCCGCCGG + Exonic
1084263241 11:67991886-67991908 GTGCGGGGCGAGGCGGCCGCGGG - Intronic
1090699061 11:129278887-129278909 GCCCGGCTCGCGGAGGCCGCGGG + Intronic
1090710085 11:129375968-129375990 GCCCGGCCCGCTGGGGCCGCGGG - Exonic
1096077638 12:48815135-48815157 GTCGGGGTCGCAGCCGCCGCCGG + Intronic
1102997452 12:117361215-117361237 ACCCGGAGCGCGGCGGCCGCGGG - Intronic
1103595373 12:122021891-122021913 GCCAGGCGCGCGGCGGCCCCGGG + Exonic
1104961475 12:132490308-132490330 GCCCGGCGCTCAGCGGCCCTCGG - Exonic
1105202762 13:18194236-18194258 GGCCGGGGCGCACGGGCCGCTGG - Intergenic
1106157333 13:27171296-27171318 GTCGGGCGGGCACCGGCCTCCGG - Intronic
1114865999 14:26597152-26597174 GGCAGGGGCGCAGGGGCCGCCGG + Intronic
1117302233 14:54441156-54441178 GTCCGGGCCGCCACGGCCGCCGG - Intronic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1119701997 14:76761854-76761876 GAGCGGCGGGCTGCGGCCGCGGG - Intergenic
1120167849 14:81220237-81220259 GCCCGGCCCGCGGCGGCCCCAGG + Intronic
1120789078 14:88562971-88562993 CTCCGGCGCGCAGTGCCGGCCGG + Exonic
1122779156 14:104136365-104136387 GTGCGGGGCGCGGCGGCGGCGGG + Intergenic
1123162031 14:106287671-106287693 GGCCGGGTCGGAGCGGCCGCTGG - Intergenic
1123500812 15:20878822-20878844 GGCCGGCGCGCAGGGGCAGGTGG - Intergenic
1123558063 15:21452517-21452539 GGCCGGCGCGCAGGGGCAGGTGG - Intergenic
1123594291 15:21889798-21889820 GGCCGGCGCGCAGGGGCAGGTGG - Intergenic
1123710202 15:22980838-22980860 GGTCGGCGCGCAGAGCCCGCTGG + Intronic
1125329181 15:38565174-38565196 GTGCTCCGAGCAGCGGCCGCAGG - Intronic
1128529153 15:68432088-68432110 GTCCGGTGTGCAGCGGCGGCGGG + Exonic
1128866029 15:71115717-71115739 GGGCGGCGCGCAGGGGACGCGGG - Intronic
1202966413 15_KI270727v1_random:179689-179711 GGCCGGCGCGCAGGGGCAGGTGG - Intergenic
1132585783 16:705336-705358 GACCGAGGCCCAGCGGCCGCGGG + Intronic
1132805008 16:1771345-1771367 GGACGGCGTGCAGCGGCGGCTGG - Exonic
1132815912 16:1826530-1826552 GGCTGGCGCGGAGCGGGCGCGGG - Intronic
1132893235 16:2214787-2214809 GGCCGGCGGGCGGCGGCGGCCGG - Exonic
1132934272 16:2473075-2473097 GCCAGGCGCGCAGCGGTTGCAGG - Exonic
1134143633 16:11742849-11742871 GTCAGCCGCGCCGCCGCCGCGGG + Exonic
1134531928 16:14990028-14990050 GTCCGGCGCGCAGCGGGCGGCGG - Intronic
1136454030 16:30370303-30370325 GCCGGGGGCGGAGCGGCCGCTGG + Intergenic
1138105689 16:54286121-54286143 CTCCGGCGCGCATCGGGGGCTGG + Exonic
1140364088 16:74368135-74368157 TTCCGGCCCGCGGCGACCGCCGG - Intergenic
1141456419 16:84145230-84145252 GACCGGCGCGCTGGGGACGCCGG - Intergenic
1142265192 16:89061199-89061221 GACCGGCGCCCAGCGGACACTGG + Intergenic
1146208308 17:30922774-30922796 GGTCGCCGCGCAGCGGCCGGTGG + Intronic
1146646586 17:34580760-34580782 GTCCGGAGCCCGGTGGCCGCGGG - Exonic
1147502701 17:40980862-40980884 GTCCAGCGCGGAGCAGCTGCAGG - Exonic
1148769014 17:50056314-50056336 CTACGGAGCGCAGCGGCCGGCGG + Intronic
1152426430 17:80220790-80220812 GCCCGGAGCGGAGCGGCCGGGGG + Intronic
1152433066 17:80260415-80260437 ACCCGGCGCGCAGCGGCCCGAGG + Intergenic
1153688228 18:7567335-7567357 GCCCCGCGCGCAGCCGGCGCGGG + Exonic
1157094858 18:44679171-44679193 CTCCGGCGCGCAGGAGCCACTGG + Intergenic
1157580598 18:48771807-48771829 GGCCGGCCCCCAGCCGCCGCGGG + Intronic
1160734760 19:657462-657484 GTCCTGCCCGCAGCGGCCGTGGG + Intronic
1161925130 19:7294130-7294152 GCCCGGGCCGCAGCGGCCGGGGG - Intergenic
1162019473 19:7862126-7862148 ATCTGGCCCGCGGCGGCCGCTGG + Exonic
1162357389 19:10194677-10194699 GTGCGGCGCGCAGCGGCAGTTGG - Intronic
1162396644 19:10421094-10421116 GTTCCGCGCGCATCCGCCGCGGG - Intronic
1163320530 19:16572124-16572146 GCCAGGCGCGCAGCAGCGGCGGG + Exonic
1165914368 19:39248545-39248567 GTCTGGGCCGCAGTGGCCGCGGG - Intergenic
1167072358 19:47228303-47228325 GCCGGGCTCGCAGAGGCCGCAGG + Exonic
1168536056 19:57171983-57172005 GTCCGGGGGGCGGGGGCCGCGGG + Intergenic
926202603 2:10812583-10812605 CCCCGGCGGGCCGCGGCCGCAGG - Intronic
927714051 2:25341441-25341463 GCCCGGCTCGCCGCTGCCGCAGG - Intronic
936433287 2:112482302-112482324 GGCCGCCGGGCAGCCGCCGCAGG - Exonic
948216713 2:236237814-236237836 GTGCAGGGCGCCGCGGCCGCCGG + Exonic
1172064243 20:32207844-32207866 GGGCGGCGCGCAGGGACCGCTGG + Intergenic
1172284639 20:33732129-33732151 CTAGGGCGCGCAGCGGCCGCGGG + Intronic
1174353201 20:49982597-49982619 GGCCGGCGCGCAGCGCCAGGGGG + Intergenic
1175902800 20:62366704-62366726 GACCGGCGCCCAGCCGCCCCCGG + Intronic
1176217796 20:63956404-63956426 GGGCGGCGCGCATGGGCCGCCGG + Exonic
1176221188 20:63969993-63970015 CCCCGTCGCGGAGCGGCCGCGGG - Intronic
1176548613 21:8212276-8212298 GGCAGGCGCGCGACGGCCGCCGG - Intergenic
1176556507 21:8256484-8256506 GGCAGGCGCGCGACGGCCGCCGG - Intergenic
1176567544 21:8395311-8395333 GGCAGGCGCGCGACGGCCGCCGG - Intergenic
1176575446 21:8439526-8439548 GGCAGGCGCGCGACGGCCGCCGG - Intergenic
1176715191 21:10343769-10343791 GGCCGGGGCGCACGGGCCGCTGG + Intergenic
1180871704 22:19150293-19150315 GGCCGGGGCGCCGCCGCCGCGGG + Intergenic
1181256861 22:21568187-21568209 GCCCGGCGCGCTGCGGCCCAGGG - Intronic
1181813710 22:25421139-25421161 GCGCGGCGGGCGGCGGCCGCGGG + Intergenic
1183328502 22:37207047-37207069 GTTCGGAGCGCCGCCGCCGCTGG + Exonic
1185255109 22:49827497-49827519 CTTCGGGGCGCCGCGGCCGCGGG + Intronic
1203253496 22_KI270733v1_random:128581-128603 GGCAGGCGCGCGACGGCCGCCGG - Intergenic
1203261551 22_KI270733v1_random:173659-173681 GGCAGGCGCGCGACGGCCGCCGG - Intergenic
954912683 3:54122374-54122396 GTCCGGCGGGCCGCGGCGGGAGG - Intergenic
955325661 3:58008160-58008182 GTCCGGCTCCCAGCCCCCGCGGG + Intergenic
961305642 3:125958110-125958132 GCCCGGCGCTCAGCGGCCCCAGG - Intergenic
961603393 3:128077042-128077064 GGGCGGCGCGCAGCGGGCGGCGG - Intronic
963503914 3:146161273-146161295 ACCGGGCGCGCAGCGGCGGCGGG - Intronic
967055210 3:185824687-185824709 GTCCGGCGGGCGGCGCCCGGCGG - Intronic
968278168 3:197456660-197456682 TCCCGGCTCGCGGCGGCCGCAGG - Intergenic
969021761 4:4143796-4143818 GTGCGGGGCGAGGCGGCCGCGGG - Intergenic
969791702 4:9497704-9497726 GTGCGGGGCGAGGCGGCCGCGGG + Intergenic
974069379 4:57110238-57110260 GGCCGGCTCGCAGGGGCCGCAGG + Exonic
976226397 4:82798273-82798295 GGCCGGGGCGCAGGGGGCGCCGG + Intronic
984952614 4:185018480-185018502 CGCAGGGGCGCAGCGGCCGCGGG - Intergenic
985512592 5:321007-321029 GGCGGGCGCGCAGAGGGCGCGGG + Intronic
985629845 5:1008730-1008752 GCGCTGCGGGCAGCGGCCGCCGG + Intergenic
985896139 5:2751067-2751089 GTTCGGCGGGCGGGGGCCGCCGG - Intronic
987090563 5:14505264-14505286 GTCCGGCAGGGAGCGGCCGGAGG + Intronic
992563241 5:77972897-77972919 GCCCGGCGCGGCGCGGCCCCCGG + Intergenic
992671879 5:79069590-79069612 TCCCGGCGCGCAGCTGCTGCGGG - Exonic
993901105 5:93584784-93584806 GGCGGGCGCGCAGCAGCAGCGGG + Exonic
996379106 5:122845735-122845757 TTCCTGGGCGCAGCAGCCGCAGG - Intronic
1001928720 5:175658079-175658101 GCCCGGAGCGCAGCCGGCGCGGG + Exonic
1002029390 5:176416619-176416641 GGTCGCCGAGCAGCGGCCGCAGG + Intergenic
1002368361 5:178730344-178730366 GTCCGGCTCGCCGTGGACGCCGG - Intronic
1004044673 6:12012375-12012397 GACCGGGGAGCGGCGGCCGCCGG + Exonic
1008545058 6:52576919-52576941 AGCGGGCGCGCAGCGGCCGGCGG + Intergenic
1010032979 6:71289118-71289140 GTCCGGCGCGGGGCTGGCGCCGG - Exonic
1011517200 6:88166816-88166838 GCCCGGCGCGCCTCGGCCTCTGG - Intergenic
1011734213 6:90296249-90296271 ATTCGGCGCGGCGCGGCCGCCGG + Intronic
1013490979 6:110646214-110646236 GTCCGACGCGCAGGAGCTGCTGG + Intronic
1013792625 6:113854835-113854857 GCCCAGCCCTCAGCGGCCGCCGG + Intergenic
1013836572 6:114342270-114342292 GTCCGGACCGCAGCAGCGGCCGG - Exonic
1014230213 6:118894612-118894634 GTTCGGCGCCTGGCGGCCGCGGG + Intronic
1019577904 7:1746369-1746391 GTCCGTCGCGGAGCCGCCGCTGG + Exonic
1020256005 7:6503506-6503528 GTCCGGCTCGCTGAGGCGGCCGG + Exonic
1020278323 7:6637557-6637579 GCCCGGCGCGGGGAGGCCGCGGG + Intronic
1020309179 7:6855826-6855848 GTGCGGGGCGAGGCGGCCGCGGG - Intergenic
1022923427 7:35037712-35037734 GTCCGGCGCAGAGGGGCGGCGGG - Intronic
1023831459 7:44040928-44040950 GTGCGGGGCGCAGCGGCAGCGGG - Intergenic
1024471832 7:49774067-49774089 GCCGGGCTCGCAGCGGGCGCAGG - Exonic
1025608193 7:63054399-63054421 GTCCGCCGCGGCGCAGCCGCCGG + Intergenic
1028762337 7:94509914-94509936 GTCGGGGGCGCCGCGGCCGCGGG + Exonic
1030193340 7:106830999-106831021 GCCCGGCGAGGAGCGGCCGGGGG - Intergenic
1030983263 7:116210783-116210805 GCGCGGCGCGCGGCGGCCGGAGG + Intronic
1035254643 7:157618563-157618585 GTGAAGAGCGCAGCGGCCGCAGG + Exonic
1035704568 8:1665721-1665743 CTCCAGCGCGCAGCGGACACCGG + Intronic
1036561443 8:9903296-9903318 GACCTCCGCGCAGCGGCCGCGGG - Intergenic
1038828513 8:31033033-31033055 GTCCCGCGCTCCGCGGCCCCAGG + Exonic
1040915703 8:52565090-52565112 GTCCGGCCGGCCCCGGCCGCGGG + Exonic
1045277506 8:100721378-100721400 GCCCGGCGCTCACCGTCCGCCGG + Exonic
1045336109 8:101205597-101205619 GGCGGGCGCGCGGCGGCGGCGGG - Intronic
1047274661 8:123396466-123396488 GGCGCGCGCGCTGCGGCCGCTGG - Intronic
1048553981 8:135457626-135457648 GCCCGGAGCGCGGGGGCCGCCGG + Exonic
1049218242 8:141417547-141417569 GTCCGGAGGGCAGGAGCCGCCGG - Intronic
1049554702 8:143276033-143276055 ATCCAGCGCGGAGCGGCCGGCGG + Exonic
1049686299 8:143940556-143940578 GTCCGGGGCGGAGCTGCCTCTGG + Intronic
1053372709 9:37576182-37576204 GGCCGGTGCGCAGAGGCTGCGGG - Intronic
1055266209 9:74498355-74498377 GCCCGGCGCGCAGTGGTCGCCGG + Intronic
1056126231 9:83538383-83538405 GCCCGCCGCGCCCCGGCCGCTGG - Exonic
1057146954 9:92764880-92764902 CTCCGGCGCGCGGGGCCCGCTGG + Intergenic
1057546257 9:96021882-96021904 GTTCCGAGCGCAGCGGCTGCGGG + Intergenic
1057869900 9:98709327-98709349 GGTCGGCGGGCAGCGGCAGCTGG - Intergenic
1060811959 9:126615170-126615192 CTCCGGCGTGGAGAGGCCGCGGG - Intronic
1060814361 9:126626922-126626944 GCCGGGCCCGCAGCGTCCGCCGG + Intronic
1060893488 9:127202900-127202922 GGCCGCAGGGCAGCGGCCGCAGG + Intronic
1061208611 9:129178126-129178148 GCCCGGCGCGCCCCGGCGGCCGG - Exonic
1061208744 9:129178657-129178679 GAGCGGCGCGCACCTGCCGCAGG - Intergenic
1061289480 9:129642410-129642432 GGACGGCGCCCAGCGGTCGCGGG - Intergenic
1062600318 9:137316303-137316325 GGCCGGCGCGCGAAGGCCGCGGG - Intronic
1203469897 Un_GL000220v1:111728-111750 GGCAGGCGCGCGACGGCCGCCGG - Intergenic
1203477718 Un_GL000220v1:155700-155722 GGCAGGCGCGCGACGGCCGCCGG - Intergenic
1187547403 X:20267114-20267136 GAGCGGAGCGCAGCGGCCGGGGG - Intergenic
1189915412 X:45851298-45851320 GTCCGGCCCGCGGTGGCCGGGGG + Intergenic