ID: 905371719

View in Genome Browser
Species Human (GRCh38)
Location 1:37486031-37486053
Sequence CTGTGAAAGGAGGAGAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1252
Summary {0: 1, 1: 3, 2: 17, 3: 143, 4: 1088}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905371712_905371719 10 Left 905371712 1:37485998-37486020 CCTCTTTCTAGATTTGAGAGAAT 0: 1
1: 0
2: 13
3: 198
4: 1584
Right 905371719 1:37486031-37486053 CTGTGAAAGGAGGAGAGGGAGGG 0: 1
1: 3
2: 17
3: 143
4: 1088
905371711_905371719 15 Left 905371711 1:37485993-37486015 CCTTGCCTCTTTCTAGATTTGAG 0: 1
1: 0
2: 3
3: 45
4: 386
Right 905371719 1:37486031-37486053 CTGTGAAAGGAGGAGAGGGAGGG 0: 1
1: 3
2: 17
3: 143
4: 1088

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905371719 Original CRISPR CTGTGAAAGGAGGAGAGGGA GGG Intergenic
900327868 1:2118751-2118773 GTGTGAGATGAGGGGAGGGAGGG + Intronic
900692155 1:3987381-3987403 CTGTACATGGAGGTGAGGGAAGG + Intergenic
900972429 1:5998949-5998971 CCGTGAAAGGAGGAAAAGGAAGG + Intronic
901090860 1:6640181-6640203 CTGTGAAAGGAGCAGACTGCAGG - Intronic
901159065 1:7161278-7161300 CTGTGCAGGGTGGAGAAGGAGGG - Intronic
901291445 1:8127357-8127379 GTGTGAACAGAAGAGAGGGATGG - Intergenic
901755990 1:11441892-11441914 ATGAGGGAGGAGGAGAGGGAAGG + Intergenic
901833346 1:11907308-11907330 CTGTGAAATGAGGAGAGAAAAGG - Intergenic
901847838 1:11995719-11995741 ATGTGTAAGGAGGAGCGTGATGG + Intronic
901975145 1:12938536-12938558 CTCTGAAAGTGGGAAAGGGAAGG - Exonic
902036913 1:13464575-13464597 GTGTGAGAGCAGGAGAGGGAGGG - Intergenic
902413796 1:16227184-16227206 CTCTCCCAGGAGGAGAGGGAAGG + Intergenic
902598492 1:17525176-17525198 ATGGGGAGGGAGGAGAGGGAGGG + Intergenic
902987022 1:20161092-20161114 CTGTGTGAGGAGGAGATGGAGGG + Intergenic
903015975 1:20362042-20362064 CTGTGGAAAGAGGAGTGGCAGGG + Intergenic
903531476 1:24033717-24033739 CTGGGAAAGGAGGAGAGATAAGG + Intergenic
903563465 1:24246466-24246488 CCCTGAAAGGAGGAGAGGGAAGG - Intergenic
904043912 1:27599253-27599275 CTCAGAAGGGAGGAGAGGGAGGG - Intronic
904205021 1:28848676-28848698 CTGTGAGAGGTGGGGAAGGAAGG + Intronic
904433488 1:30479631-30479653 CTGGGGAAGGAGTGGAGGGAAGG - Intergenic
904463450 1:30693953-30693975 ATGGGAAAGGAGGCGAGGGCTGG + Intergenic
904527000 1:31141285-31141307 CTATCAAAGGAGGAGAGGAGAGG + Intergenic
904893065 1:33793751-33793773 GTGTGGACGGAGAAGAGGGAGGG + Intronic
905000377 1:34663590-34663612 CTGGGAAAGGAAGAGAGAGGCGG - Intergenic
905036303 1:34920129-34920151 CTGTGAGAGGAGTAGAGAGAAGG - Intronic
905198585 1:36300863-36300885 CTGTGAAAAGAGAAGAGCCAGGG - Intronic
905228063 1:36492869-36492891 CTGTGGCAGGAGGATGGGGATGG + Intergenic
905371719 1:37486031-37486053 CTGTGAAAGGAGGAGAGGGAGGG + Intergenic
905371747 1:37486150-37486172 CTCTGAGAGGGGGACAGGGATGG + Intergenic
905682487 1:39884014-39884036 CTGTGAAAGAATAATAGGGACGG - Intergenic
905746386 1:40422137-40422159 CTGTGGAAAGGGGAGAGCGAGGG - Exonic
906004284 1:42455829-42455851 CCGGGAAAGGGAGAGAGGGAGGG + Intronic
906190718 1:43898045-43898067 CTGAGAAAGGAGGTGATGGCAGG - Intronic
906239434 1:44233356-44233378 TTGTGACAGGAGGAGAGGACTGG - Intronic
906253923 1:44332830-44332852 CTTTGGAAGGAGGAGGGGCAAGG + Intronic
906263381 1:44409453-44409475 CGCTGAAAGGAGGAGAAAGAAGG - Intronic
906472674 1:46144262-46144284 CTCTGAAAGGAGCAGAGGTGAGG + Intronic
906667844 1:47634103-47634125 CAGGGAAAGGAAGACAGGGAGGG - Intergenic
907255144 1:53173439-53173461 AGGGGAGAGGAGGAGAGGGAGGG - Intergenic
907255151 1:53173458-53173480 AGGGGAGAGGAGGAGAGGGAGGG - Intergenic
907255158 1:53173477-53173499 AGGGGAGAGGAGGAGAGGGAGGG - Intergenic
907255165 1:53173496-53173518 AGGGGAGAGGAGGAGAGGGAGGG - Intergenic
907330069 1:53664939-53664961 CTGTGGCAGGAGGAGGGGGAGGG + Intronic
907332991 1:53683493-53683515 CTGTGAAATGGGGAGAATGAGGG + Intronic
907615503 1:55920719-55920741 CTGTGAAAGGGGGGGTGGGAAGG + Intergenic
907696069 1:56730401-56730423 GAGGGGAAGGAGGAGAGGGAGGG + Intronic
907809347 1:57852711-57852733 CTGGGGCAGGAGGAGAGGTAGGG - Intronic
907922743 1:58928740-58928762 CTCTGAAAAGATAAGAGGGAGGG - Intergenic
908145078 1:61233108-61233130 CTGTGAAAGGCAAGGAGGGAGGG - Intronic
908173137 1:61527679-61527701 CTGAGGAAGGGGGAAAGGGAAGG + Intergenic
908364651 1:63408165-63408187 TTGGGAAAGGAGGAGGGAGAAGG - Intronic
908389928 1:63675240-63675262 GTGTGGGAGGGGGAGAGGGAAGG - Intergenic
908432733 1:64074509-64074531 CTGTGCAAGGCACAGAGGGAGGG + Intronic
908874088 1:68649717-68649739 CTGTGAAAGGGAAAGAAGGATGG - Intergenic
908959917 1:69684450-69684472 AGGTGAAAGAAGGGGAGGGAAGG + Intronic
909074800 1:71040158-71040180 AAGAGAGAGGAGGAGAGGGAAGG + Intronic
910005156 1:82387460-82387482 GTGGGAAAGGAAGAGAGGAAGGG + Intergenic
910250679 1:85195483-85195505 ATCTAAAAGGAGGAGAGGGATGG + Intronic
910570331 1:88694278-88694300 CAGGGGATGGAGGAGAGGGAAGG - Intronic
911450539 1:98054824-98054846 CTGTGAATTGGGGAGAGGGAGGG + Intergenic
911634772 1:100222744-100222766 CAGTGAAAGGAGGAGAAAGAGGG - Intronic
911653062 1:100411469-100411491 CTAAGAAAGGAGGAAAAGGAAGG - Intronic
912041109 1:105391896-105391918 CTGGGAAAGGAGGAGAGATAAGG - Intergenic
913161756 1:116151857-116151879 CTGTGACAGCAGGAGAGGATGGG - Intergenic
913387554 1:118276083-118276105 CAGGGAAAGGAGGAGACAGAAGG + Intergenic
913692689 1:121294224-121294246 AGGAGAAAGAAGGAGAGGGATGG - Intronic
914017677 1:143835529-143835551 GGGTGAAAAGAGGAGAGAGAAGG - Intergenic
914144867 1:144985866-144985888 AGGAGAAAGAAGGAGAGGGATGG + Intronic
914656287 1:149744064-149744086 GGGTGAAAAGAGGAGAGAGAAGG - Intergenic
914817222 1:151071770-151071792 CTGTGAAAGAAGCAGAGGCGAGG - Intronic
914931311 1:151936387-151936409 TTGGGAAAGGAGGAGAGATAAGG - Intergenic
914956767 1:152169648-152169670 CTGTCCCAGGAGAAGAGGGAAGG + Intergenic
915083759 1:153370284-153370306 CTGGGAAAGGAGGAAAGATAAGG - Intergenic
915164576 1:153941480-153941502 ATGTGGAGGGAGGACAGGGATGG - Intronic
915289355 1:154872567-154872589 CTGCGGATGGAGGAGAGGGAGGG - Intergenic
915558707 1:156674462-156674484 CCAGGAAAGGAGGAGAGGCAAGG - Intronic
915624985 1:157108984-157109006 CTGTGTAACGAGGAGAGTGGAGG - Intergenic
915929954 1:160054163-160054185 GTGTGAAAGGTTGAGAGGGCAGG - Intronic
915938477 1:160103066-160103088 CTGGGAATGGAGAAGTGGGATGG - Intergenic
916063510 1:161118258-161118280 CTGGGAGAGGCGGGGAGGGACGG + Intronic
916128017 1:161588612-161588634 CCGTGGAAGGAGGAAAAGGAAGG - Intronic
916137935 1:161670442-161670464 CCGTGGAAGGAGGAAAAGGAAGG - Intronic
916433231 1:164752457-164752479 ATGTGGAAGGAGGAGAGGAGGGG + Intronic
916473098 1:165142798-165142820 CAAAGAAAGGAAGAGAGGGAGGG - Intergenic
916508027 1:165445500-165445522 CTGTGAAAGGAGGAGGGGGTGGG + Intergenic
916728393 1:167544158-167544180 CTGTGCATGCAGGAGAGGCACGG - Intronic
916851021 1:168703699-168703721 TGGGTAAAGGAGGAGAGGGAAGG + Intronic
916937487 1:169644779-169644801 GGAAGAAAGGAGGAGAGGGAGGG - Intergenic
917052178 1:170937048-170937070 CTGGGAAAGGAGGAGAGATAAGG + Intronic
917685795 1:177414501-177414523 CAGAGAAAGGAGCAGAGGAAGGG + Intergenic
917709046 1:177665932-177665954 CTGGCAAAAGAGCAGAGGGAAGG + Intergenic
917740527 1:177958066-177958088 CGGTGAGTGGTGGAGAGGGATGG + Intronic
917954913 1:180085135-180085157 CTGTGAAATAAGGGAAGGGAAGG - Intronic
918285528 1:183051016-183051038 ATTTGAAAGGAGAAGAGGAAAGG - Intronic
918876144 1:190046307-190046329 GGAAGAAAGGAGGAGAGGGAGGG + Intergenic
919061626 1:192641397-192641419 GGGAGGAAGGAGGAGAGGGAAGG + Intronic
919116583 1:193287232-193287254 CTGTGAAAGAATGAAATGGAGGG + Intergenic
919260501 1:195187625-195187647 CAGGGAAAGGAAAAGAGGGATGG - Intergenic
919667607 1:200307086-200307108 CTGTGAAAGTATGAGAAGCATGG - Intergenic
919757628 1:201075722-201075744 CTGTGGAATGAAAAGAGGGAAGG - Intronic
919911422 1:202113302-202113324 CTGGGGCAGGTGGAGAGGGATGG - Intergenic
920060621 1:203224740-203224762 CCATGAAATGAGAAGAGGGAGGG - Intronic
920173549 1:204086229-204086251 CAGTGAACTGAGGAGGGGGAGGG - Intronic
920175245 1:204097113-204097135 CTGTGACAGGAGGGAAGGCAGGG - Intronic
920229298 1:204460015-204460037 GTGTGAGCTGAGGAGAGGGAGGG - Intronic
920384394 1:205558551-205558573 CTGTCAAAAGAGGAGAGGAGAGG + Intergenic
920419331 1:205820465-205820487 CAGGGAGAGGAGGGGAGGGAAGG - Intergenic
920480009 1:206312585-206312607 AGGAGAAAGAAGGAGAGGGATGG - Intronic
920518179 1:206602207-206602229 CTGTGGAAAGAGTGGAGGGAAGG - Intronic
920527599 1:206679243-206679265 TTGGGAAAGGAGGAGAGGAAAGG - Intronic
920679006 1:208058714-208058736 CTGTGAAAGGAGCCTGGGGAGGG - Intronic
920705629 1:208248518-208248540 TTGTGAAGGGAGGAGAGGGGAGG - Intergenic
921160338 1:212467985-212468007 CCCAGCAAGGAGGAGAGGGATGG - Intergenic
921252441 1:213310485-213310507 CTGTGAAAGAACCAGAAGGAAGG - Intergenic
922029166 1:221781420-221781442 CTGGGAAAGGAGGAGAAGCCGGG + Intergenic
922148629 1:222976348-222976370 CTGTGAAAGGAGGCTAGCCAGGG - Intronic
922247748 1:223817247-223817269 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247756 1:223817265-223817287 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247764 1:223817283-223817305 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247772 1:223817301-223817323 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247780 1:223817319-223817341 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247788 1:223817337-223817359 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247796 1:223817355-223817377 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247804 1:223817373-223817395 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922251217 1:223850246-223850268 CTGAGGAATGAGGGGAGGGAGGG + Intergenic
922338740 1:224638570-224638592 CTGTAAAAGGAGGGGTGGCAGGG + Intronic
922468343 1:225860205-225860227 CTGTGCAAGGAGCTGAGGCAGGG + Intronic
922901322 1:229138910-229138932 CTGTGCCCAGAGGAGAGGGAAGG - Intergenic
923284047 1:232474073-232474095 CTGTGAATGGGGAAAAGGGATGG + Intronic
923713570 1:236406195-236406217 CTGTGATAGGAGGAGGGAGAAGG + Intronic
923742122 1:236664464-236664486 CTATGAAAGGAAGAAAGGAATGG - Intergenic
923779232 1:237007417-237007439 CAGTAAAGGGAGGAGAGAGAGGG - Intergenic
924699326 1:246435156-246435178 CTATTAAAGGAGAAGAGGAAAGG + Intronic
924824645 1:247526584-247526606 CTGAGAAATGTGGAGAGTGAAGG - Intronic
1063039342 10:2320834-2320856 GTGTGTAAGGAAGAGAGGAAGGG + Intergenic
1063093833 10:2891485-2891507 CTGGGAAATGAGAAGAGTGAGGG + Intergenic
1063371020 10:5523292-5523314 GTGAGAAAGGAGGGGAGGGTGGG + Intergenic
1063373583 10:5538100-5538122 TGGTGAAAGGAAGAGAGAGAGGG - Intergenic
1063865983 10:10366162-10366184 CTGAGAAAGAGAGAGAGGGAGGG + Intergenic
1064199016 10:13269056-13269078 CTGGGAAGGGAGGAGAGATAAGG + Intergenic
1064226695 10:13492378-13492400 CTCCGAAAGGAGGAGGGTGATGG - Intronic
1064267342 10:13835833-13835855 TGGTGAAAGGGGGAGGGGGATGG - Intronic
1064296456 10:14083442-14083464 CTCTGCAAGAAGGTGAGGGAGGG + Intronic
1064478298 10:15715337-15715359 AGGGGAATGGAGGAGAGGGAGGG + Intronic
1065235769 10:23649948-23649970 GTGGGAAAGTAGGGGAGGGAAGG + Intergenic
1065638533 10:27755401-27755423 CTGTGAAGTGAGGAGTCGGAAGG - Intergenic
1065659436 10:27990417-27990439 CTTTGGAAGGTGGAGATGGAAGG - Intronic
1065866401 10:29918986-29919008 AAGTGAAAGGAGGGGAGGGAAGG - Intergenic
1066199030 10:33128094-33128116 GTGGGAAAGGAGGGGAGGGGAGG - Intergenic
1066242375 10:33550839-33550861 CTTGGGAAGGAGGAGGGGGAAGG - Intergenic
1066594377 10:37033417-37033439 CTATGAAAAGACAAGAGGGATGG + Intergenic
1066626819 10:37415527-37415549 GAGGGAAAGGAGGAGAAGGAGGG + Intergenic
1067083908 10:43228253-43228275 CTGCTGAAGGAGGGGAGGGAGGG - Intronic
1067242091 10:44505863-44505885 CTGTGAGATGAGGAGACTGATGG + Intergenic
1067294170 10:44965239-44965261 CTATGGAAGGAGGAGAGGCTTGG + Intronic
1067325491 10:45262119-45262141 CTGGGAAAGGAGGAGAGATAAGG - Intergenic
1067659555 10:48224201-48224223 CTGTGAAGAGAGCAGAGGGGTGG - Intronic
1067746428 10:48939832-48939854 CAATGAAATGAGGAGGGGGATGG + Intronic
1068338719 10:55673096-55673118 GAGTGAAAGGAAGAGAGAGAAGG + Intergenic
1069277561 10:66611586-66611608 GTGAGAAATGAGGAGAGGGCAGG - Intronic
1069313453 10:67068234-67068256 ATGTGGAAAGAGGAAAGGGAGGG + Intronic
1070383752 10:75904972-75904994 CAGTGGAAGGAGGGGAGAGAGGG + Intronic
1070574843 10:77670258-77670280 GAGGGAAAGGAAGAGAGGGAGGG + Intergenic
1070727495 10:78802362-78802384 CTCAGAAAGGAGGAGAAGGGAGG + Intergenic
1070889582 10:79932860-79932882 CAGAGAGAGGATGAGAGGGATGG - Intergenic
1071026265 10:81117632-81117654 CGGGGAAAGGAGGAAGGGGAGGG + Intergenic
1071251473 10:83823959-83823981 CTGGGGAAGGAAGGGAGGGAGGG - Intergenic
1071399658 10:85256891-85256913 CTGGCAAAGGAGGAGATGGAAGG - Intergenic
1071712383 10:88062337-88062359 CTGTGTGAGGAGGTGGGGGATGG - Intergenic
1071828686 10:89350820-89350842 CTGGGAAGGGAGGAGAGATAAGG + Intronic
1071964970 10:90843192-90843214 CTGCGGAAGGAAGGGAGGGAGGG - Intronic
1072236613 10:93459219-93459241 CTGTTAGATGAGGAGAGGGAAGG - Intronic
1072715746 10:97751353-97751375 CTATGACAGAAGGAGAAGGATGG - Intronic
1072800032 10:98386277-98386299 CTCTAGAAGGAAGAGAGGGAGGG + Intronic
1072932396 10:99677826-99677848 CTGTAAAACAAGGAGAGTGAAGG - Intronic
1073045953 10:100638212-100638234 CTGGGAAAGGAGCAGAAGGAGGG + Intergenic
1073175403 10:101553395-101553417 AGGTGAAAGGAGGAGAGGAGGGG - Exonic
1073322120 10:102621707-102621729 CCCTGAGAGGAGGAAAGGGAGGG + Intronic
1073348510 10:102802089-102802111 AGGTGGAAGGAGGAGGGGGAAGG - Intronic
1073430127 10:103480556-103480578 CTCTGAGCGGAGGAGAGGGCGGG + Intergenic
1073801941 10:107051026-107051048 TTGTGGAAGGAAGGGAGGGAAGG - Intronic
1074227326 10:111497546-111497568 GTTTAGAAGGAGGAGAGGGATGG + Intergenic
1074939720 10:118222945-118222967 CTCTGAAAGGTGGATGGGGAGGG + Intergenic
1074975794 10:118580681-118580703 GAGGGAAAGGAGGAGAGGAAAGG + Intergenic
1075709465 10:124522829-124522851 CTGACAAATGAGTAGAGGGAAGG + Intronic
1075959928 10:126559580-126559602 AGGTGAAAGGAGAGGAGGGAGGG - Intronic
1076066902 10:127456012-127456034 AGGAGAAAGGGGGAGAGGGAGGG - Intergenic
1076323713 10:129604116-129604138 GTATGAAATGGGGAGAGGGAGGG + Intronic
1076523282 10:131094346-131094368 CTCTGTAAGGAGAAGTGGGAGGG - Intronic
1076853978 10:133106280-133106302 GTGTGAATGGAGGGGAGTGATGG - Intronic
1077027010 11:444682-444704 CAGTGAAGGGTGGAGAGGGAGGG + Intergenic
1077066975 11:645675-645697 CAGAGAAAGGAGGTGGGGGATGG + Intronic
1077245720 11:1536867-1536889 ATGTGAAATGAGCAGAGGGAAGG + Intergenic
1077328144 11:1972478-1972500 GTCTCAAAGGAGGGGAGGGACGG - Intronic
1077608919 11:3631905-3631927 TTGTGAAAGGAAGTGAGAGAGGG + Intergenic
1077644583 11:3912163-3912185 GGGAGAAAGGAGGAGAGGGGAGG - Intronic
1077761544 11:5104910-5104932 GTGAGGAAGGAGAAGAGGGAGGG - Intergenic
1078515584 11:12019273-12019295 CTATAAAAGGAGGACAGGAACGG + Intergenic
1078770147 11:14342109-14342131 GTGGGGTAGGAGGAGAGGGAAGG - Intronic
1079253465 11:18805657-18805679 TGGGGAAAGGAGGACAGGGAAGG + Intergenic
1080373726 11:31683071-31683093 CTTTGTGGGGAGGAGAGGGAAGG - Intronic
1080383706 11:31798451-31798473 CTGGGAAAGGGGGCTAGGGAGGG + Intronic
1080606872 11:33870665-33870687 TTCTGAAAGGTGCAGAGGGAGGG - Intronic
1080684185 11:34502024-34502046 CAATGAAGAGAGGAGAGGGAAGG + Intronic
1080711304 11:34750250-34750272 CTGGGAAGGGTGGAGAGGGAAGG + Intergenic
1080753995 11:35178035-35178057 ATATGAAAGGAGCAGAGAGAGGG + Intronic
1080849419 11:36055346-36055368 CTGAGAGAGAAAGAGAGGGAGGG - Intronic
1081612150 11:44569039-44569061 CTGTGAGAGGTGGGAAGGGAGGG + Intronic
1081644227 11:44778586-44778608 CTGTAAAATGGGGAGAGGGATGG + Intronic
1082085072 11:48043586-48043608 CGGTCAAAGCAGAAGAGGGAAGG + Intronic
1082627217 11:55500725-55500747 CTGGGAAAGGAGGAGAGATAAGG - Intergenic
1082674154 11:56075112-56075134 CTGTGGCAGGAGGATGGGGAGGG - Intergenic
1083399128 11:62411809-62411831 CTGGGGAAGCAGGAGTGGGAAGG - Intronic
1083511677 11:63214534-63214556 TTGGGAAAGGAGGAGAGATAAGG - Intronic
1083884634 11:65566418-65566440 GAGGGAAAGGAGGAGGGGGAGGG - Intergenic
1083970879 11:66074165-66074187 CTGGGAAGTGAGAAGAGGGATGG - Intronic
1084154794 11:67307526-67307548 CTGAGACAGGAGGAGAGGCTGGG - Intronic
1084313312 11:68329346-68329368 CTGTAAAATGAGGGTAGGGATGG - Intronic
1084484671 11:69440924-69440946 CTGTGGAAGGCGGAGAAGAAGGG + Intergenic
1084569913 11:69953131-69953153 ATGGGGAAGGGGGAGAGGGACGG + Intergenic
1084608128 11:70184322-70184344 CTGTGAAAAGAGGAAGGGGCTGG + Intronic
1084722060 11:70913101-70913123 CTGTGAGAGGATGGGAGGGTAGG - Intronic
1084868703 11:72081004-72081026 CTGTGAAAGGTGATGAGGGTCGG - Intronic
1085025294 11:73232949-73232971 AGGGGTAAGGAGGAGAGGGAGGG + Intronic
1085155248 11:74287292-74287314 CTGGCAAAGGAGGAAAGGAAGGG + Intronic
1085246662 11:75107472-75107494 CAGTGAAAGGAGGAATGGGGAGG - Intronic
1085267298 11:75244530-75244552 CACTGAAAGGAAGGGAGGGAGGG - Intergenic
1085448544 11:76617083-76617105 CTGGGAAAGGAAGGGAGGGGAGG - Intergenic
1085456043 11:76665959-76665981 CTGTGTAAGGCGGAGAGGAAAGG + Intronic
1085641926 11:78198107-78198129 TTCTGAGAGGAAGAGAGGGAGGG - Intronic
1085715323 11:78867488-78867510 ATGGGAGAGGGGGAGAGGGAAGG + Intronic
1085780131 11:79400796-79400818 CTGTGGGAGGAGGAGAGCAAGGG - Intronic
1085789622 11:79485863-79485885 AGCTGAAGGGAGGAGAGGGAGGG - Intergenic
1085802515 11:79603516-79603538 CTTTGGAAGGATGAGAGGGAAGG - Intergenic
1086250963 11:84813860-84813882 CAGTGAGAGGTGTAGAGGGAGGG - Intronic
1087788801 11:102385287-102385309 CTGGGAAAGGAGGAGAGATAAGG + Intergenic
1087961413 11:104355112-104355134 CTTTGGGAGGACGAGAGGGATGG - Intergenic
1088305342 11:108401441-108401463 CTGGGAAAGAAGGAGAGATAAGG - Intronic
1088545575 11:110955509-110955531 ATGTGCAATGAGGAGGGGGATGG + Intergenic
1089118119 11:116112580-116112602 TTGGGAAAGAAGCAGAGGGAGGG + Intergenic
1089254048 11:117184702-117184724 CTGTGATAGGAGGGGAAAGAAGG + Intronic
1089270816 11:117300252-117300274 GTGTGTAAGGTGGAGAGGGGAGG - Intronic
1089279958 11:117366996-117367018 CTGTGAAAGGAGGAGACAGAAGG + Intronic
1089719789 11:120404844-120404866 CTGTTGAGGTAGGAGAGGGAGGG - Intronic
1090241907 11:125189814-125189836 CAGGGAAGGAAGGAGAGGGAGGG - Intronic
1090247743 11:125228880-125228902 CTTTGATAGGAGGAATGGGATGG + Intronic
1090282226 11:125465925-125465947 CTGGTCAAGGAGGGGAGGGAAGG - Intronic
1090401749 11:126453681-126453703 CTGGGAAGGGAGGAGGCGGAGGG - Intronic
1090410349 11:126503781-126503803 CAGAGAGAGAAGGAGAGGGAGGG - Intronic
1090472220 11:126990430-126990452 CTGGGAAGGGACGGGAGGGATGG - Intronic
1090494663 11:127198797-127198819 AGGAAAAAGGAGGAGAGGGAGGG - Intergenic
1090843536 11:130513062-130513084 CTGTGAGGGGAGAAGAGGGCAGG + Intergenic
1090877610 11:130804890-130804912 CTGCGACAGGAAGAGAGGGTTGG + Intergenic
1090907973 11:131094215-131094237 CTGAGGAAGGAAGAGAGGCAGGG - Intergenic
1091154978 11:133363670-133363692 CTGTGAAAGGAGGTATGGCAGGG + Intronic
1091218176 11:133916277-133916299 GAGAGAAAGGAGGAGAGGCAGGG + Intronic
1091356473 11:134941597-134941619 TTGGGAAAGGAGGACCGGGATGG - Intergenic
1202811123 11_KI270721v1_random:27658-27680 GTCTCAAAGGAGGGGAGGGACGG - Intergenic
1091397528 12:163170-163192 CTGTGGAGGGAGGAGAGGGGAGG - Intronic
1091397552 12:163231-163253 CTGTGGAGGGAGGGGAGGGGAGG - Intronic
1091397566 12:163263-163285 CTGTGGAGGGAGGGGAGGGGAGG - Intronic
1091397580 12:163295-163317 CTGTGGAGGGAGGGGAGGGGAGG - Intronic
1091397594 12:163327-163349 CTGTGGAGGGAGGAGAGGGGAGG - Intronic
1091397606 12:163359-163381 CTGTGGAGGGAGGAGAGGGGAGG - Intronic
1091586613 12:1820563-1820585 CTGAGAAGGAAAGAGAGGGATGG - Exonic
1091591451 12:1845315-1845337 CTCTGAGAGGGGGCGAGGGAAGG + Intronic
1091653884 12:2330172-2330194 CTATGAGATAAGGAGAGGGAGGG - Intronic
1091849069 12:3680500-3680522 CATGCAAAGGAGGAGAGGGATGG - Intronic
1091936910 12:4441865-4441887 CTCTGAGGGGCGGAGAGGGAGGG + Intronic
1092040178 12:5377262-5377284 CTGTGAGAGTGGGAGAGAGATGG + Intergenic
1092233754 12:6792777-6792799 CTGAAAAAGGAGAAGAGGCAAGG + Intronic
1092246873 12:6868614-6868636 CTGTTAAAAGAGCAGAGGGCAGG + Intronic
1092386904 12:8042751-8042773 CATTGAAAGGAGGAGTAGGAAGG + Intronic
1092440145 12:8494152-8494174 CTGTCAGGGGAGGATAGGGAGGG - Intergenic
1092770598 12:11892958-11892980 CTGTGACAGTAGGAGTGGGCTGG - Exonic
1093140956 12:15509781-15509803 CTGTGCACAGAGGAGAGTGAGGG + Intronic
1093662230 12:21770517-21770539 CTGTGAAAGAAGCAGAGGGAAGG + Intronic
1093901739 12:24643197-24643219 CTGTGAAAGAAAGAAAGAGAGGG + Intergenic
1094646418 12:32328870-32328892 CTGTGGAAACAGGAGATGGAGGG + Intronic
1095225721 12:39674766-39674788 CTGTGAGAGAAGGCCAGGGATGG - Intronic
1095414432 12:41960693-41960715 TTGAGAAAGGAAGGGAGGGAGGG + Intergenic
1095445755 12:42280422-42280444 ATTTGAAAGGAGGAGAAGGCAGG - Intronic
1095741183 12:45608728-45608750 GAGAGAGAGGAGGAGAGGGAAGG - Intergenic
1095818076 12:46446713-46446735 AGGTGAAAGGAGGGGAAGGAGGG + Intergenic
1095873506 12:47055964-47055986 CTGGGAAGGGAGGAGAGATAAGG - Intergenic
1095959548 12:47825599-47825621 CTGGGAGAGGAGGGTAGGGAGGG - Intronic
1096996465 12:55841235-55841257 CTCTGAAGGAGGGAGAGGGATGG + Exonic
1097015864 12:55986896-55986918 CTGTAAAGGGGGGAGGGGGAAGG - Exonic
1097092938 12:56521911-56521933 GAGGGAAAGGGGGAGAGGGAGGG - Exonic
1097214397 12:57398783-57398805 CTGAGAAAGGAAGAGAGGGCTGG - Intronic
1097246868 12:57611756-57611778 CTGTGGGAGGGGGGGAGGGAGGG - Intronic
1097844407 12:64351901-64351923 CTGTGAAGCGAGGACAGAGAAGG - Intronic
1098366224 12:69706057-69706079 CTGTGACAAGAGGAGAGACATGG - Intergenic
1099176488 12:79428603-79428625 GTGTGAGAAGAGGAGGGGGACGG + Intronic
1100206718 12:92357792-92357814 CAGAGAGAGGAGCAGAGGGAGGG - Intergenic
1100373806 12:93993877-93993899 CTGTGAGAGGTGAGGAGGGAAGG + Intergenic
1100420218 12:94425059-94425081 GAGGGAAAGGGGGAGAGGGAGGG + Intronic
1101695648 12:107123342-107123364 CTGGGAAGGAGGGAGAGGGAAGG - Intergenic
1101833049 12:108274315-108274337 TAGTGAAAGAAGAAGAGGGAGGG + Intergenic
1101858404 12:108463049-108463071 AGGGGAAAGGAGGAGAGAGAGGG + Intergenic
1101996401 12:109528302-109528324 CTGAGAAAGGGGGAGAGGAAGGG - Intronic
1102576371 12:113858561-113858583 ATGTGAAACTAGGGGAGGGAAGG + Intronic
1102624182 12:114221088-114221110 GGGAGAAAGGAGGAGAGGGAAGG + Intergenic
1102678936 12:114677074-114677096 CTTTGAAAGGGGGTGGGGGAGGG + Intronic
1102926260 12:116828667-116828689 GTGGGCAAGGAAGAGAGGGAGGG + Intronic
1102968360 12:117146701-117146723 CTGTGAATAGAGGAGAGGGGTGG - Intronic
1103241094 12:119413967-119413989 CTGGGAGAAGAGGTGAGGGAGGG - Intronic
1103366747 12:120389463-120389485 CTGTTAGAAGAGGAGGGGGAGGG + Intergenic
1103540344 12:121661867-121661889 CTGTGAAAGAAAGAAAGAGAAGG + Intronic
1103768382 12:123299886-123299908 CTGTGAAAAGAAAAGAAGGAGGG + Intronic
1104004615 12:124883222-124883244 GAGTGAAAGGAAGGGAGGGAGGG + Intergenic
1104372603 12:128237107-128237129 CTCTGAAAGGAGGGTAGGGAGGG - Intergenic
1104769225 12:131350450-131350472 CTGGGAAGGGAGGAGAGATAAGG + Intergenic
1105420586 13:20248410-20248432 CTCTGTAAGGAGCAGTGGGATGG + Intergenic
1105456207 13:20543543-20543565 CTGGGAAAGGAGGAGAGATGAGG - Intergenic
1105600963 13:21886390-21886412 CAGTGACAGGAAGCGAGGGATGG + Intergenic
1105831404 13:24165540-24165562 CTGAGAGAGGAGAAGAGGGCAGG - Intronic
1106235017 13:27854049-27854071 CTGTGGAAGGAAAGGAGGGAGGG - Intergenic
1106474096 13:30082533-30082555 CTGTCCAAGGAGCAGAGGCATGG + Intergenic
1106549450 13:30758792-30758814 ATGTGAAGGGAGGGAAGGGAAGG - Intronic
1106971647 13:35147655-35147677 CTGGGTCAGGAGGTGAGGGAAGG + Intronic
1107112663 13:36714787-36714809 CCTTGAGAGGAGGAGATGGAAGG + Intergenic
1107395081 13:40007063-40007085 TTGTGAGATGAGGAGAGGAAAGG + Intergenic
1107715052 13:43191788-43191810 CTCTGAGAGGCGGAGGGGGAGGG + Intergenic
1107938177 13:45362512-45362534 CTGAAAAGGGAGGAGATGGATGG - Intergenic
1108001484 13:45909339-45909361 CTGTCAGAGGAGGAAAGGGCTGG + Intergenic
1108257640 13:48626132-48626154 CTGGGAAAGGAGGAGAGATAAGG - Intergenic
1108534531 13:51360312-51360334 GTTTGAATGGAGGAGAGGGGTGG + Intronic
1108685721 13:52817483-52817505 CCGTGCAAAGGGGAGAGGGAGGG - Intergenic
1110151488 13:72260158-72260180 CAGAGATAGGAGGAGAGGCAGGG + Intergenic
1110651385 13:77946296-77946318 ATGTTAGAGGATGAGAGGGAAGG + Intergenic
1110904451 13:80867913-80867935 AAGAGAAAGGAGGAGAGGAAGGG + Intergenic
1111598521 13:90441991-90442013 GTGTGAAAGGAGAAGGAGGAGGG - Intergenic
1112038179 13:95517102-95517124 AAGAGAAAGGAAGAGAGGGAGGG - Intronic
1112395574 13:99027721-99027743 CACTGGAAGGAAGAGAGGGAGGG + Intronic
1112542315 13:100327221-100327243 CTGGGAAAGGGGTAGAGGGAGGG - Intronic
1112776979 13:102854976-102854998 CTGGGAAAGGAAGAGGTGGAGGG - Intronic
1113098875 13:106695742-106695764 CTGTGAGAGAAGGACAGGGAGGG + Intergenic
1113326532 13:109287457-109287479 ATGAGAAAGGAAGAGAGGGAGGG + Intergenic
1113360784 13:109629432-109629454 CTGGGAAAGGAAGAGATGAATGG + Intergenic
1113367013 13:109685484-109685506 GGGTGGAAGGAGGAGTGGGAGGG + Intergenic
1113614539 13:111671195-111671217 CTGTGAAAGGACGGCAGGGCAGG + Intronic
1113618042 13:111694924-111694946 CAGTGGAGAGAGGAGAGGGAGGG - Intergenic
1113618055 13:111694983-111695005 CAGTGGAGAGAGGAGAGGGACGG - Intergenic
1113620007 13:111756109-111756131 CTGTGAAAGGACGGCAGGGCAGG + Intergenic
1113623575 13:111780185-111780207 CAGTGGAGAGAGGAGAGGGAGGG - Intergenic
1113623588 13:111780244-111780266 CAGTGGAGAGAGGAGAGGGACGG - Intergenic
1113643305 13:111973696-111973718 CAGAGAGAGGAGGAGAGAGATGG - Intergenic
1113745085 13:112738716-112738738 CTGGGGGAGGAGGAGGGGGACGG - Intronic
1114054434 14:18954596-18954618 CAGGGGAAGGAGGAGATGGAAGG - Intergenic
1114108120 14:19447336-19447358 CAGGGGAAGGAGGAGATGGAAGG + Intergenic
1114219318 14:20682851-20682873 CTGTGAACGCCGGAGAGGGCGGG - Intergenic
1114422762 14:22598420-22598442 CTGGAAAAGGAAGAGCGGGAAGG - Intronic
1114441129 14:22748902-22748924 CTGTCAAAGGAGAAGGGGCACGG + Intergenic
1114627053 14:24136630-24136652 CTCTGCAAGTAGGACAGGGATGG - Intronic
1115249332 14:31329608-31329630 CTGTGAAAGTAGGTGGGGCAGGG - Intronic
1115304092 14:31916062-31916084 ATGTGAAGGGAAGAGAGGTAAGG - Intergenic
1115421487 14:33199740-33199762 TAGTGAAAGGAGGGGAGGAAGGG - Intronic
1115499453 14:34036241-34036263 TGGTGAAAAGGGGAGAGGGAAGG - Intronic
1115550308 14:34499144-34499166 CTGTGAATGGAGGGGAGGTTAGG + Intergenic
1115765372 14:36617841-36617863 GAGGGAAAGGAGGAGAGGCAGGG + Intergenic
1116395921 14:44448583-44448605 CAGTTAAAGGAGGGGATGGAAGG + Intergenic
1116402217 14:44521733-44521755 TTCTGTATGGAGGAGAGGGAGGG + Intergenic
1116871311 14:50071238-50071260 CTGTAAAATTAGGAGAGGGTGGG - Intergenic
1117035236 14:51721617-51721639 TTGAGAAAGAAAGAGAGGGAGGG + Intronic
1117378425 14:55136806-55136828 CTGGGAAAGGTAGTGAGGGAGGG - Intronic
1117959852 14:61152062-61152084 CTGTGAAAGGACAGGAGGGAAGG + Intergenic
1118353384 14:64990487-64990509 GTGTGAAGGATGGAGAGGGAGGG - Intronic
1118550050 14:66940201-66940223 CTGTGAAGAGAGGACAGGGAAGG + Intronic
1118735269 14:68696599-68696621 CAGTGAGAGGAGCAGAGGGCTGG - Intronic
1118961446 14:70537362-70537384 CTGTACAAGGAAGAGAGTGAAGG - Intergenic
1119038252 14:71248795-71248817 CTTTCAAAGGAGGAGGAGGAGGG - Intergenic
1119045835 14:71318220-71318242 CTGTGGAAGGAAGGAAGGGAGGG - Intergenic
1119453652 14:74735334-74735356 CTGGGAAAGGAGGAGAGATAAGG + Exonic
1119514783 14:75239611-75239633 GAGTGGAAGGAGGAGAGGGCTGG - Intronic
1119607491 14:76033223-76033245 CTATGAAAAAAGGAAAGGGATGG + Intronic
1119932062 14:78557028-78557050 CGGAGAGGGGAGGAGAGGGAAGG - Intronic
1120486659 14:85122551-85122573 CTGTGAAAGGAAGAGAGGAGAGG - Intergenic
1120747222 14:88163374-88163396 ATATGAAAGGAAGGGAGGGAAGG + Intergenic
1120990931 14:90376792-90376814 CTGTAAAAAGAGGAGCAGGAAGG - Intergenic
1121333330 14:93061503-93061525 GTGAGAAAGGAGGGGAGGGAGGG + Intronic
1121345369 14:93131766-93131788 CTGTGGAAGGCCGAGATGGAAGG - Intergenic
1121717829 14:96088807-96088829 CGGTGAAGGGAGGAGAAGGCAGG + Exonic
1121719811 14:96101394-96101416 ATGTAAGAGGAGGACAGGGAGGG - Intergenic
1121798383 14:96754120-96754142 GTGTGGAAGGGGGAGAGGGAAGG + Intergenic
1121850272 14:97215551-97215573 GAGGGAAAGGAGGGGAGGGAGGG + Intergenic
1121860172 14:97309887-97309909 CTGTGGAAGCAAGAGAGAGAGGG - Intergenic
1122036897 14:98955626-98955648 GTGTGGATGTAGGAGAGGGAAGG + Intergenic
1122172150 14:99885751-99885773 CAGTGAAAGGAGGAGGAAGAGGG + Intronic
1122206021 14:100148434-100148456 ATGAGAAAGGAGGAAGGGGAAGG - Intronic
1122258839 14:100500397-100500419 CTGTGGAGGGTGGAGAAGGAGGG + Intronic
1122439321 14:101719164-101719186 CTGTGAGGGGAGGGGAGGGGAGG + Intergenic
1122454870 14:101842346-101842368 CTGAAACAGGAGGAGAGGGCAGG + Intronic
1122539745 14:102491508-102491530 GTGTGAAAAGAGGAAAGGGCTGG - Intronic
1122623804 14:103074128-103074150 CTGGTGCAGGAGGAGAGGGAGGG + Intergenic
1122804732 14:104250604-104250626 CTGGTAAAGGTGGAGGGGGAGGG + Intergenic
1123223325 14:106876774-106876796 CTGAGAAGGGAGGAGAGGTAAGG - Intergenic
1123538116 15:21260280-21260302 CTGTGAAATGAGGGATGGGAGGG - Intergenic
1124199314 15:27663794-27663816 CTGGGAAAGGAGGAGAGATAAGG + Intergenic
1124686661 15:31788719-31788741 ATGTGAATGGAGGAGAGAAAAGG + Intronic
1125469763 15:39991216-39991238 GTGGAAAGGGAGGAGAGGGAAGG + Intronic
1125749455 15:42018872-42018894 CTATAAAAGTAGGAGTGGGAAGG - Intronic
1126388772 15:48122482-48122504 CTGGGAAAGGAAGATGGGGAGGG - Intronic
1126430563 15:48579117-48579139 CTTTGAAAGGAGGGCAGGCAGGG + Intronic
1126528349 15:49683871-49683893 TTGAGAAAGTAGGAGAGGGATGG + Intergenic
1126812060 15:52416814-52416836 CTGGGAAAGGAGGAGAGATAAGG + Intronic
1127055336 15:55125699-55125721 CTTTGGGAGGTGGAGAGGGAAGG - Intergenic
1127269870 15:57390796-57390818 CTGTGGGAGGAGCAGAAGGATGG + Intronic
1127271971 15:57409622-57409644 GTGTGAAAGGGGGAGGGAGAAGG + Intronic
1127409220 15:58688650-58688672 CTGTCGAAAGAGGGGAGGGAAGG + Intronic
1127451279 15:59118781-59118803 CTGAAAAAGGAGGAGATGGCAGG - Intronic
1127546869 15:60000499-60000521 AGGGGAAAGAAGGAGAGGGAGGG + Intergenic
1127619808 15:60722849-60722871 TTGTGAGACGTGGAGAGGGAAGG - Intronic
1128243200 15:66115456-66115478 TTGTGATGGGAGGAAAGGGAGGG - Intronic
1128254039 15:66184368-66184390 CTGTGGAAGAGGGAGGGGGATGG - Intronic
1128264339 15:66253827-66253849 CTGGGAGGGAAGGAGAGGGAGGG - Intergenic
1128351954 15:66896850-66896872 AGGAGAAAGGAGGAGGGGGAAGG + Intergenic
1128713183 15:69887355-69887377 ATGTGGAAGGAAGGGAGGGAAGG - Intergenic
1128781785 15:70363095-70363117 CTGGAGAAGGAGGAGAGGAAGGG + Intergenic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1128875671 15:71199228-71199250 AACTGAAAGGAGGAAAGGGATGG - Intronic
1129144310 15:73633267-73633289 CGGGGAAGGGAGGGGAGGGAGGG + Exonic
1129156140 15:73719394-73719416 CCGTGAAAGGAGAAGGGGGAGGG - Intergenic
1129272671 15:74427755-74427777 CTGTGACAGGAGGTGAGAGCAGG - Intronic
1129326917 15:74805047-74805069 GTGAGAGTGGAGGAGAGGGAAGG + Intergenic
1129780352 15:78265722-78265744 AAGTGAAAGGAGGAACGGGAGGG - Intronic
1130240159 15:82180664-82180686 ATGTTAAAAGGGGAGAGGGAAGG - Intronic
1130290661 15:82597615-82597637 TTGGGAAAGGAGGAGAGACAAGG + Intronic
1130637797 15:85641727-85641749 CTTTGGAAGGATGAGGGGGATGG - Intronic
1130665373 15:85864862-85864884 CTTTGAAAGCAGGTGTGGGAGGG - Intergenic
1131230599 15:90656161-90656183 CTGTGAAGGGAAGGAAGGGAAGG + Intergenic
1131329209 15:91480661-91480683 CTGTGTAAGCAGGAGACAGAAGG + Intergenic
1131364597 15:91827596-91827618 CAATGAAAGGAGGAAGGGGAGGG + Intergenic
1131759135 15:95600936-95600958 TTGGGAAAGGAGGAGAGGGAAGG + Intergenic
1131885243 15:96905320-96905342 CTTTGAGAGGACGAGATGGAAGG + Intergenic
1132026280 15:98406870-98406892 CTGGGGTAGGAGGAGAAGGAAGG - Intergenic
1132146461 15:99432587-99432609 CTGGGACAGGGAGAGAGGGAAGG + Intergenic
1132459060 16:41149-41171 CTGGGAAAGGAGGAGAGATAAGG - Intergenic
1132710256 16:1263192-1263214 CTGCGCAGGGAGGAGAGGGCTGG + Intergenic
1132716518 16:1292712-1292734 CTGGGAAAAGGAGAGAGGGAGGG - Intergenic
1132803762 16:1766423-1766445 CTGGGGCAGGAGCAGAGGGAAGG + Intronic
1132924361 16:2420794-2420816 CTAAGAAAGGAGGAAGGGGAAGG - Intergenic
1133030454 16:3008431-3008453 CTGGGAAAAGAGGTGGGGGAGGG - Intergenic
1133088999 16:3389208-3389230 CTGGCAAAGGAGGGGAGGGATGG + Intronic
1133098807 16:3466732-3466754 CTTTGAGAGGAAGAGGGGGAAGG + Intronic
1133356095 16:5138114-5138136 CTGTCATTGGAGGAGAGCGATGG - Intergenic
1133439313 16:5807233-5807255 CCGTGAAGGGAGAGGAGGGATGG - Intergenic
1133485370 16:6214546-6214568 CAGGGAGAGGGGGAGAGGGAGGG + Intronic
1133572364 16:7054123-7054145 GTGTGAAAGGAAAAGAGGGAGGG - Intronic
1133966085 16:10532555-10532577 CTGTGATGGGAGGAGAGGAGAGG - Exonic
1134204521 16:12226411-12226433 GTTTAAAAGGAGGAGAGAGAGGG + Intronic
1134871556 16:17656585-17656607 ATGAGAAAGGAGGAGATGCAGGG + Intergenic
1134890762 16:17839773-17839795 CTGAGAAAGAAGAGGAGGGAGGG + Intergenic
1135077902 16:19410190-19410212 CTGGGAAAGGAGGGGAGAGAAGG + Intergenic
1135113359 16:19707663-19707685 CTGTGTAGGGAGGTGGGGGAGGG - Intronic
1135434933 16:22420526-22420548 CTGTGGATGCAGGAGATGGACGG - Intronic
1136144951 16:28311078-28311100 GTGTGGAAGGAGAAGAAGGAGGG + Intronic
1137357041 16:47777072-47777094 CTGAGAAAAGGAGAGAGGGAAGG + Intergenic
1137592362 16:49701461-49701483 AGGTGAGAGGAGGAGAGGGGAGG + Intronic
1137748487 16:50841129-50841151 CTGGGAAAGGAGAAGTTGGAAGG + Intergenic
1137984611 16:53097403-53097425 CTGTGAAAGAAAGAGAAAGAAGG - Intronic
1138103070 16:54270099-54270121 GTGTGAATGAAGGACAGGGATGG + Intronic
1138154883 16:54693752-54693774 ATGAGGCAGGAGGAGAGGGAGGG + Intergenic
1138202543 16:55100921-55100943 CTGTGGAAGGAAGAGAGGGAGGG + Intergenic
1138354931 16:56369992-56370014 CTATGAAAGGTGGAAAGGTAGGG + Intronic
1138453363 16:57106682-57106704 CTGTGAAGTGAGGAGGGGGTAGG + Intronic
1138658822 16:58506224-58506246 CAGTGAGAGGAGGACAGGCAGGG + Intronic
1139062253 16:63266588-63266610 CTTGGGAGGGAGGAGAGGGAAGG - Intergenic
1139584159 16:67890712-67890734 CTGGGAAAGGAGGAGAGATAAGG + Intergenic
1139643920 16:68313535-68313557 CTGAGGCAGGAGGAGAAGGAGGG - Intronic
1139782284 16:69361832-69361854 ATGTCCAAGGAAGAGAGGGAGGG - Intronic
1139963498 16:70731377-70731399 CAGGAAAAGGAGGAGAGAGAAGG + Intronic
1140134661 16:72195315-72195337 CTGTGAAAAGGAGAGGGGGAAGG - Intergenic
1140686472 16:77438303-77438325 TTGTAAGAGGAGCAGAGGGAGGG + Intergenic
1140781456 16:78300559-78300581 ATGCGAAAGGAAGAGAGGGAAGG - Intronic
1140914582 16:79482862-79482884 GAGGGAGAGGAGGAGAGGGAGGG - Intergenic
1141202742 16:81910399-81910421 CTGTTCTAGGAGCAGAGGGAAGG + Intronic
1141448905 16:84083425-84083447 CAGAGAAAGGAGGAAAGAGATGG + Intronic
1141625358 16:85258634-85258656 CTGTGGGAGGAGGAGGGAGAGGG + Intergenic
1141890301 16:86922072-86922094 CTGGGGAAGGAGGAAGGGGAAGG + Intergenic
1142044116 16:87914302-87914324 CTGTGGATGCAGGAGATGGACGG - Intronic
1142430630 16:90024581-90024603 CTGGGAAGGGAGGAGAGACAAGG + Intronic
1142669335 17:1480486-1480508 GTGTGACAGGAGGAAAGCGAGGG + Intronic
1143071344 17:4296547-4296569 CTTTAAAAGGAGGAGAGGCCAGG - Intronic
1143101962 17:4509463-4509485 CTGTGAAAGGAGGAGAGGAAAGG + Intronic
1143129947 17:4671869-4671891 CAGGGAGAGGTGGAGAGGGAAGG - Exonic
1143901245 17:10176363-10176385 CTGTGCAGGGAGGAGAGTGGGGG - Intronic
1143963518 17:10739299-10739321 CTGTGGGAGGAAGCGAGGGAGGG - Intergenic
1144379577 17:14681041-14681063 CTGAGAAACGTGGGGAGGGAGGG - Intergenic
1144465522 17:15493747-15493769 GTGAGAAAGGAAGGGAGGGAGGG - Intronic
1144676204 17:17163621-17163643 CTAAGACAGGAGGAGAAGGAAGG - Intronic
1144725515 17:17499987-17500009 CTGTGCAAGCAGGAGCAGGACGG + Intergenic
1144948925 17:18983698-18983720 CTGTGGAGGGTGGAGAGGGGTGG + Intronic
1145016699 17:19403390-19403412 ATGTGAAGCGAGGAGAGGTAAGG - Intergenic
1145192096 17:20851887-20851909 CTGCGGAAGGAGCAGAGGGGAGG - Intronic
1145402317 17:22551920-22551942 CTGCGGAAGGAGCAGAGGGGAGG - Intergenic
1146584324 17:34069204-34069226 GAGGGAAAGGAAGAGAGGGAGGG - Intronic
1146672708 17:34752769-34752791 GGGTGAGAGGAGGAGAGTGAAGG - Intergenic
1146977907 17:37131491-37131513 TTTTTAAAGGAGGAGAGGAAAGG - Intronic
1147214368 17:38890789-38890811 GTGTGAATGGGGAAGAGGGAGGG - Intronic
1147387387 17:40090442-40090464 GTGTGGAAGGAGGAGGTGGATGG - Intronic
1147441006 17:40447223-40447245 CTGTGACAGGAGGGCAGGCAGGG - Intronic
1147808977 17:43153354-43153376 CTGGGAAAGGAGGAGAGATAAGG - Intergenic
1147879268 17:43643422-43643444 GTGGGAAAGGAGGGAAGGGAGGG + Intronic
1148074376 17:44927079-44927101 CTGGGGAGGGAGGACAGGGAAGG + Intronic
1148083729 17:44981676-44981698 CTGCCAAGGCAGGAGAGGGATGG - Intergenic
1148086145 17:44994993-44995015 CAGAGGAAGGAGGAGAGGGGAGG + Intergenic
1148319293 17:46736486-46736508 CAGGGTAAGGAGTAGAGGGAGGG - Intronic
1148464775 17:47858213-47858235 CTGGGCAAGGAGGAGAAAGATGG - Intergenic
1148588722 17:48799513-48799535 ATGTGAAATGAGGGGATGGAGGG - Intronic
1149623969 17:58066689-58066711 CTGTGAAAGGAAAAGAAAGAAGG + Intergenic
1149626266 17:58083090-58083112 CTGAGAGAGGAGGAGAGGGAAGG - Intergenic
1149682478 17:58515775-58515797 CTATGGAAGGAAGGGAGGGAAGG + Intronic
1150424842 17:65069021-65069043 CTGGGAAAGGAGACTAGGGATGG - Intergenic
1150564395 17:66325864-66325886 GGGGGAAAGGTGGAGAGGGATGG - Intronic
1150850970 17:68703429-68703451 GTGTGAAAGGAGAAGAGACAGGG + Intergenic
1150900300 17:69267542-69267564 CTGTTAAAGGATAAAAGGGACGG + Intronic
1151144770 17:72030635-72030657 CTGTGAAGGGAAGGGAGGAAAGG - Intergenic
1151182032 17:72336230-72336252 CTGGGAAGGGAGGGGAGGGGAGG - Intergenic
1151201887 17:72474806-72474828 CTCTACAAGGAGGAGAGGGTTGG + Intergenic
1152201836 17:78951963-78951985 CTAGGAAGGGAGGAGAGGGAGGG - Intergenic
1152228449 17:79103255-79103277 CTGTGAGCAGAGGAGAGGGAAGG + Intronic
1152289001 17:79428269-79428291 CAGTGAGGGGAGGTGAGGGAGGG + Intronic
1152561860 17:81082648-81082670 CTGTGGAGGGAGAAGAGGAAAGG - Intronic
1152915562 17:83032961-83032983 CTGGGTCAGGAGGAGAGGAACGG + Intronic
1153012482 18:551630-551652 CTGTCAAATGTGGAGAGGGCAGG + Intergenic
1153268344 18:3294522-3294544 CTCTTACAGGAGAAGAGGGAAGG + Intergenic
1153525142 18:5987579-5987601 CTGCTAAAGGTGGAGAGGGGAGG - Intronic
1153641183 18:7158505-7158527 ATCTGAAAGGAGGAGAAAGAGGG - Intergenic
1153736932 18:8080897-8080919 CTGCTATAGGAGGAGAGCGATGG - Intronic
1153771505 18:8420602-8420624 CTGTAAAAGGAGAAGAGACACGG - Intergenic
1153828428 18:8898426-8898448 CTTTGGAAGGAGGAGAAAGATGG + Intergenic
1153873313 18:9341036-9341058 GAGTGAAAGGGAGAGAGGGAGGG - Intronic
1154072248 18:11163144-11163166 CAATGAGAGGAGGAGGGGGAGGG - Intergenic
1154280472 18:12997553-12997575 CTGGGAAAGGAGGAGAGATAAGG + Intronic
1155680158 18:28477719-28477741 CTGTGGAAGGAAGGAAGGGAAGG - Intergenic
1156214712 18:34984614-34984636 GGGGGAAAGGAGGAAAGGGATGG + Intronic
1156838057 18:41579216-41579238 CTGTGAAAAATGGAGAGGGGGGG + Intergenic
1157171889 18:45414865-45414887 CTCTGAAAGGAGAGAAGGGAAGG - Intronic
1157284037 18:46364993-46365015 CTGTGACAGGAGAAGAGTGAGGG + Intronic
1157525371 18:48376558-48376580 CTGAGAGAGGAGGGGTGGGAGGG - Intronic
1157554746 18:48606197-48606219 CTGAGGAAGGGGGAAAGGGACGG - Intronic
1157594027 18:48852989-48853011 CTTTGAAAAGATGAGAGTGAGGG - Intronic
1157597906 18:48875033-48875055 CTGGGCCAGGAGGAGATGGAGGG + Intergenic
1157605317 18:48922771-48922793 CTGTGGAAGGAGGGGAGAGAGGG - Intronic
1157663710 18:49467839-49467861 CTGAGAAATGAAGAGAGTGAGGG + Intergenic
1159623469 18:70667232-70667254 AAGGGAAAGGAGGGGAGGGAAGG - Intergenic
1159623489 18:70667278-70667300 AAGGGAAAGGAGGGGAGGGAAGG - Intergenic
1159843623 18:73430969-73430991 GTGGGCAAGGAGGAGAAGGAAGG - Intergenic
1160462931 18:79053024-79053046 CGATGAAAGCAGGATAGGGACGG - Intergenic
1160511884 18:79457468-79457490 CTGAGAAGGGAGAGGAGGGAGGG - Intronic
1160829788 19:1098388-1098410 CAGTGAAAAGAGGGGTGGGAGGG + Intergenic
1161151313 19:2711529-2711551 GAGTGGAGGGAGGAGAGGGAAGG - Intergenic
1161178774 19:2865478-2865500 CTGGGAAGGGAGGAGAGATAAGG - Intergenic
1161270516 19:3387074-3387096 CTGGGATAGAGGGAGAGGGAGGG + Intronic
1161681957 19:5684608-5684630 CTGAGAAGGGTGGAGGGGGAGGG + Intronic
1162101553 19:8342407-8342429 CAGGGAGCGGAGGAGAGGGAAGG - Intronic
1162298549 19:9829899-9829921 CTGTGAATGGATGAGAGGGGTGG + Intronic
1162877086 19:13628346-13628368 AGGGGAGAGGAGGAGAGGGAAGG + Intergenic
1163235778 19:16029623-16029645 CTGGGACAGGAGCAGAGGGCGGG + Intergenic
1163518976 19:17780795-17780817 CTGAGGAAGCAGGAGAGGGAGGG + Intronic
1163779630 19:19239632-19239654 GAGTGGAAGGAGGAGGGGGAGGG - Intronic
1163865377 19:19769482-19769504 CCGTGCAAAGGGGAGAGGGAGGG - Intergenic
1164011550 19:21207013-21207035 TTGGGAAAGGAGGAGAGATAAGG + Intergenic
1164526370 19:29016409-29016431 GAGAGAAAGGAGGAGAGAGAGGG - Intergenic
1164864565 19:31593140-31593162 CTGTGAGAGGAGGAGAGGCCAGG + Intergenic
1164937023 19:32223024-32223046 CTGGGAAAGGAAGGGAGGGAGGG + Intergenic
1165730801 19:38143418-38143440 CAGGGAAAGGAGGAGAGGGTGGG - Intronic
1165775472 19:38402043-38402065 CTTTGGAAGGCTGAGAGGGAAGG + Intergenic
1166315587 19:41987842-41987864 CTGTGAAAAGCTTAGAGGGATGG + Intronic
1166398875 19:42463122-42463144 AGGTGAAAAGAGGAGAGTGAAGG + Intergenic
1166961004 19:46495737-46495759 CTGTGTCAGGGAGAGAGGGAGGG - Exonic
1167112010 19:47468170-47468192 CTGGGCAAGGGGGAGAGGGTGGG - Intronic
1167114893 19:47483456-47483478 GTGTGTAAGGAGGAGGGCGAAGG + Intronic
1167177308 19:47873987-47874009 CTGAGAAATGAGGACAAGGACGG - Intronic
1167523266 19:49969527-49969549 CTGTGAAAGGAGAAGTTGGGAGG + Intergenic
1167651130 19:50729647-50729669 CTATGGAAGGAAGGGAGGGAGGG + Intergenic
1167698785 19:51030244-51030266 CGGGGAATGGAGGAGGGGGAGGG - Intronic
1167702056 19:51054635-51054657 GTGAGCAAGGAGGAGAGGGTGGG - Intergenic
1167793352 19:51693772-51693794 CTGGGGAAGGTGCAGAGGGAGGG + Intergenic
1167978625 19:53254330-53254352 CTGTCAGAGAAGGAGAGGAAGGG - Intronic
1168056715 19:53868574-53868596 CTGGGAAAGGAGGAGAAGACAGG + Intronic
1168302584 19:55414669-55414691 CTGGGAAAGGGGTGGAGGGAAGG + Intergenic
1168328904 19:55554647-55554669 GTGTGGAATGAGGAGACGGATGG + Intergenic
1168379528 19:55908191-55908213 CTAGGAGAGGTGGAGAGGGAAGG - Intronic
1168564014 19:57407658-57407680 CTTTGAAAGGTGGAGGTGGAAGG - Intronic
1168577927 19:57528495-57528517 CTTTGAGATGAAGAGAGGGAGGG + Intronic
925112985 2:1352292-1352314 ATTTGAAAGGAGCAGAGGGGAGG - Intronic
925166673 2:1719870-1719892 GTGTGAAAGAGAGAGAGGGAGGG + Intronic
925190714 2:1881137-1881159 CTGTGAGAGGAGGAGGAGGCAGG + Intronic
925240355 2:2320350-2320372 CAGTAAGAGGATGAGAGGGATGG + Intronic
925416752 2:3675759-3675781 GTGTGAATGGTGGAAAGGGAGGG - Intronic
925911009 2:8573649-8573671 CTGTGCAAGGTGGTGGGGGAAGG + Intergenic
925921229 2:8639274-8639296 CTGAGAATGGAGGGGTGGGATGG - Intergenic
925987172 2:9225908-9225930 CTATGAAAGGAGGAAGGGAAGGG - Intronic
926086378 2:10022812-10022834 CAGAGAAAGGAAGGGAGGGAGGG - Intergenic
926138186 2:10352262-10352284 CAGTGAGATGGGGAGAGGGAAGG - Intronic
926329399 2:11812366-11812388 CAGTGCTAGGAGGAGAGGGAAGG + Intronic
926589058 2:14720265-14720287 GTGTGAGAGAGGGAGAGGGAGGG - Intergenic
927691711 2:25213174-25213196 CAGTTGGAGGAGGAGAGGGAGGG - Intergenic
927768281 2:25833927-25833949 CTCTGAAATTAGGAGAAGGAAGG - Intronic
928075596 2:28261750-28261772 AGGGGAAAGGAGGAGAGGGGAGG - Intronic
928098975 2:28423751-28423773 CTGTCAAATCAGGAGAAGGAGGG - Intergenic
928336887 2:30405890-30405912 CTAGGAGAGGACGAGAGGGAAGG + Intergenic
928374212 2:30761878-30761900 GTGGGAAAGGAGGAGAGGCCAGG + Intronic
928443383 2:31312063-31312085 CTAGGAAGGGAGGAGATGGAGGG - Intergenic
928726209 2:34176712-34176734 CTGTGATAGGAGAAGAGAAATGG + Intergenic
929237898 2:39625761-39625783 AGGGGAATGGAGGAGAGGGAAGG + Intergenic
929243590 2:39677644-39677666 CTGTGTTTGGAGGAGTGGGATGG + Intronic
929336372 2:40751584-40751606 CTGTGAAAGTAACATAGGGAAGG + Intergenic
929444391 2:41991535-41991557 CTCCAAAAGGAGGAGTGGGAGGG + Intergenic
929609188 2:43257285-43257307 CTGGGAGAGGCAGAGAGGGAAGG + Intronic
929747952 2:44678762-44678784 CTGAGAAAAGATGAGAAGGAAGG - Intronic
930088773 2:47516968-47516990 CTTTGTAGGGTGGAGAGGGAGGG - Exonic
930158297 2:48127643-48127665 ATGTGAAGGAGGGAGAGGGAGGG + Intergenic
930619764 2:53631441-53631463 CGGTGAAAAGGTGAGAGGGAGGG + Intronic
931236180 2:60414143-60414165 TTGGCAAAGGAGGAGGGGGAAGG - Intergenic
931459842 2:62441104-62441126 CTGTCCCAGGAGGAGAAGGATGG + Intergenic
931464262 2:62473106-62473128 CTCTTAATGGAGGAGAGGGAGGG - Intergenic
931730245 2:65146968-65146990 TTGTGAGAGGAGGAAATGGATGG + Intergenic
931743126 2:65266688-65266710 CACTGAGAGGAGGGGAGGGATGG + Intronic
932327625 2:70873537-70873559 CTGTTAAAGAAGGAGACAGAAGG - Intergenic
932449994 2:71803426-71803448 CTGGGAAGGAAGAAGAGGGAGGG - Intergenic
932482296 2:72051714-72051736 CTCTGGAAGGAGGTGATGGAAGG - Intergenic
932518512 2:72380631-72380653 CTCAAAAAAGAGGAGAGGGAAGG + Intronic
932831111 2:74990971-74990993 CTGTGATGGGAGTAGAGGAAGGG - Intergenic
932836540 2:75043358-75043380 ATTTGAAATGGGGAGAGGGAAGG + Intergenic
933227898 2:79772137-79772159 TAGTGAAAGGAAGAAAGGGAAGG - Intronic
934484840 2:94696099-94696121 GTGTGAGAGGGAGAGAGGGAGGG + Intergenic
934557566 2:95295518-95295540 CAGTGAAAGGAGGATGGGGCTGG + Intergenic
934675540 2:96247169-96247191 GTGTGAAAGCAGGAAAGGAAGGG - Intergenic
934776519 2:96941372-96941394 TTCTGAGAGGAGGAGTGGGAAGG + Intronic
935064635 2:99636932-99636954 CTGTGAGCGGAGGTGAGGGCAGG + Intronic
935197442 2:100826047-100826069 CTGAGAAAGGTGGAGAGTTATGG - Intronic
935600540 2:104917629-104917651 CTTTGTAAGGAAGTGAGGGAAGG + Intergenic
936055199 2:109257354-109257376 GAATGAAAGAAGGAGAGGGAGGG + Intronic
936071217 2:109372693-109372715 GTGTGAGAGCAGGAGAGTGAAGG - Intronic
937028113 2:118715910-118715932 ATGAGAAAGGAAAAGAGGGATGG + Intergenic
937038679 2:118803824-118803846 CTGGGGAAGGAGCAGCGGGAGGG - Intergenic
937255494 2:120552573-120552595 CTGTAAAAGGCGGGGAGGGTGGG - Intergenic
937332000 2:121037536-121037558 TCATGAAAGGAAGAGAGGGAGGG - Intergenic
937477800 2:122230345-122230367 GTGGGAAAGGAGAAAAGGGATGG + Intergenic
938487940 2:131733670-131733692 CTGTGAAATGAGGGATGGGAGGG + Intronic
938494448 2:131786038-131786060 CTGGGAAAGGAGGAGAGATGAGG - Intergenic
938692298 2:133802713-133802735 CTTTGAAAGGAGGAGGGTGAGGG + Intergenic
939056748 2:137374140-137374162 CTGTGGCATGAGGGGAGGGAGGG + Intronic
939596881 2:144136319-144136341 CTGTCAAAAGAGGGGAGGGGAGG + Intronic
940205434 2:151196887-151196909 AGGAGAAGGGAGGAGAGGGATGG - Intergenic
940344966 2:152619585-152619607 CTGGGAGAGGAGGAGGCGGAGGG - Exonic
940424677 2:153516856-153516878 CTGTGTAAAGAGAAGTGGGAAGG - Intergenic
940471356 2:154104524-154104546 CTGGAAAAGGAGGTGAAGGAGGG - Intronic
940826450 2:158417599-158417621 CTGTGAAAGGAGAGACGGGAAGG - Intronic
940879792 2:158935310-158935332 CTGAGAAAGGAGGAGAAGATGGG - Intergenic
940931073 2:159432203-159432225 CTGTGGAATGAGGAGAGGGAAGG + Intronic
941184392 2:162303579-162303601 AAGTGAAAGGAAGAGAGGGAAGG + Intronic
941662098 2:168205569-168205591 CTGAGGAAGGTGGGGAGGGACGG + Intronic
941691331 2:168503327-168503349 CTGTGAAAGCAGTAGAGTCATGG + Intronic
941822527 2:169856817-169856839 CCGTGCAAAGGGGAGAGGGAGGG + Intronic
941919972 2:170840599-170840621 CTCAGAAAGGAAGGGAGGGAGGG + Intronic
942066349 2:172275318-172275340 CTGAGCAAGGAAGAAAGGGAAGG - Intergenic
942085287 2:172437826-172437848 CCATGGCAGGAGGAGAGGGAGGG + Intronic
942174895 2:173323811-173323833 CTATGAAAGAAGGAAAGGAAGGG - Intergenic
942188808 2:173450620-173450642 ATGAGAAAGGAAAAGAGGGAAGG + Intergenic
942313257 2:174675838-174675860 GTGTGAGGGGAGGAGTGGGAGGG + Intronic
942658796 2:178242419-178242441 CTGGGAAAGGAGGAAAGAGGAGG - Intronic
942743523 2:179206531-179206553 CTGTGAAATGAGGTCAGGAATGG - Intronic
942766629 2:179465041-179465063 CTTTGACAGGAGGATAAGGATGG - Intronic
942839226 2:180339705-180339727 CTCAGAAAGAACGAGAGGGATGG + Intergenic
943008243 2:182413137-182413159 TTGTGAAAGGAGGAAAGAGATGG + Intronic
943464909 2:188217549-188217571 GAAAGAAAGGAGGAGAGGGAAGG - Intergenic
943757201 2:191569151-191569173 CTGTGGGAGGGGGAGAGGGGAGG + Intergenic
943850723 2:192718907-192718929 CTGTGCAAGGATGTGAGAGAGGG + Intergenic
944045861 2:195411214-195411236 ATGTGCCAGGAGGAGAGGAAGGG + Intergenic
944257790 2:197641401-197641423 CTGGGAGAGAAGAAGAGGGAGGG + Intronic
944537483 2:200725458-200725480 CTGTCAAAGGGTGAGGGGGAGGG - Intergenic
944665222 2:201954017-201954039 CTGGGAAGGGTGGGGAGGGAGGG - Intergenic
945266054 2:207892564-207892586 CTGTCAAGGGTGGAGAGGGAAGG - Intronic
945675673 2:212852655-212852677 CTTTGAAAGGAAGAAAGAGAAGG - Intergenic
945772450 2:214061213-214061235 ATGTGAAAGGATTAGAGGAAGGG + Intronic
945956294 2:216089177-216089199 AAGTTAAAGGAGGTGAGGGAAGG + Intronic
946077981 2:217091580-217091602 CTGGGACAGGAGGAGATAGAAGG + Intergenic
946404506 2:219485134-219485156 CTGTGGGAGGAGCAGAGGGCTGG + Intronic
946689600 2:222300376-222300398 CTGTCAAAGGAGGTGGGGGAGGG - Intronic
947160133 2:227206472-227206494 GTGGGAACTGAGGAGAGGGAAGG + Intronic
947394342 2:229672453-229672475 CTGAGAAAGAAAGGGAGGGATGG + Intronic
947909705 2:233792953-233792975 CTGGGTAAGGAGCAGATGGAGGG + Intronic
948061884 2:235048170-235048192 CTGTTAATGTGGGAGAGGGAAGG + Intronic
948317052 2:237035929-237035951 CTAGGAAAGGAGGAAAGTGAAGG + Intergenic
948393064 2:237626588-237626610 CTGGGGAAGGATGGGAGGGAGGG - Intergenic
948533180 2:238626523-238626545 CTGAGAAAGGAGAACAAGGAGGG - Intergenic
948590653 2:239047593-239047615 CTGTGACAGGGGAGGAGGGAAGG + Intergenic
948733024 2:239979336-239979358 GTGTGACTGGAGGAGAGGGGTGG - Intronic
948735065 2:239998236-239998258 CTGGGTAAGGAGGAAAGTGAAGG - Intronic
948854493 2:240723810-240723832 CTGAGATGGGAGGAGAGCGAGGG - Intronic
1169081632 20:2800720-2800742 CTCGGAGAGGAGGAGAGGGCCGG + Intergenic
1169214103 20:3783910-3783932 CTGGGAAAGGAGCAGCTGGACGG + Exonic
1169325854 20:4675797-4675819 CTATAAAAGGAGGAGAGAGTGGG + Intergenic
1169680271 20:8204201-8204223 GTGTCAAGGGAGCAGAGGGATGG + Intronic
1170129822 20:13007377-13007399 ATGTGAAAAGAGGAAAGAGATGG + Intergenic
1170223735 20:13967726-13967748 CTGTGAAATGAAGAGGGTGACGG + Intronic
1170305484 20:14933264-14933286 CTGTGACAAGAGGATAGGAATGG + Intronic
1170329578 20:15193752-15193774 CTGTGAGAGTAGGAGAATGAAGG - Intronic
1170756672 20:19212063-19212085 CTGTGCCAGGGGAAGAGGGACGG - Intergenic
1170791394 20:19512239-19512261 CCCTGAAGGGAGGAAAGGGAGGG + Intronic
1170846034 20:19962672-19962694 CTGTGAATTGAGGTGAAGGAAGG + Intronic
1171201838 20:23247945-23247967 CTGTGAAAGGAGGAGGGGGACGG + Intergenic
1171256642 20:23693589-23693611 CTGTGACAGGAGGAGAGGGCAGG - Intergenic
1171263994 20:23755520-23755542 CTGTGACAGGAGGAAAGGGCAGG - Intergenic
1171279533 20:23884063-23884085 CTGTGACAGGAGGAGAGGGCAGG - Intergenic
1171284606 20:23926641-23926663 CTGTGACAGGAGGAAAGGGCAGG - Intergenic
1171334223 20:24368980-24369002 CTGTGAAGGGATGAGAAGCAAGG - Intergenic
1171493767 20:25539826-25539848 CTGTGGAAGGATGATAGAGAAGG - Intronic
1171953395 20:31440999-31441021 GTGTGTGAGGAGGAGTGGGAGGG + Intronic
1172223769 20:33290856-33290878 CTGAGGAAGGAGGTGAGGGCTGG + Intronic
1172423958 20:34842391-34842413 CTGTGAAAGGAGGGGAAGGAAGG + Intergenic
1172815469 20:37682676-37682698 GTGGGAAAGGAAGACAGGGAGGG + Intergenic
1172890204 20:38258939-38258961 GTGTGAAAGCAGGAGAGGCTTGG + Intronic
1172919816 20:38472103-38472125 CTGAGAAAGAAGAGGAGGGAGGG - Intergenic
1172959569 20:38789017-38789039 CTGTTAGAGGAGGGCAGGGAAGG + Intergenic
1173201634 20:40959413-40959435 GAGAGAAAGGAGGAGAGGGAAGG + Intergenic
1173375422 20:42478203-42478225 GGGTGAAAGGAGAAGGGGGAAGG + Intronic
1173430408 20:42982741-42982763 GTGGGAGAGGAGCAGAGGGATGG - Intronic
1173868632 20:46328603-46328625 CTGTGGAAGGAGGAGAGGAATGG - Intergenic
1173900384 20:46583447-46583469 CAGTGAAAGGAGAAGCAGGAAGG + Intronic
1174006604 20:47415983-47416005 CTGTGAAAGGAAGGAAGGAAGGG + Intergenic
1174204532 20:48828729-48828751 CTGGGAAAGGTGGAAAGGGCAGG - Intergenic
1174372173 20:50098394-50098416 CTGTGTGAGGATGAGAGTGAAGG + Intronic
1174519865 20:51121109-51121131 CTCTGGAAGGAAGTGAGGGAAGG + Intergenic
1175469883 20:59220008-59220030 GAGAGAAAAGAGGAGAGGGAGGG + Intronic
1175472997 20:59246217-59246239 CTGTCAGAGAAGGAGAGTGAAGG - Intronic
1175716571 20:61258407-61258429 CTGAGAAACGGGGAGAGGCAAGG - Intronic
1175876521 20:62232810-62232832 CTGGGAGAGGAGGTCAGGGAGGG - Intronic
1175921104 20:62450986-62451008 AGGTGAGAGGAGGGGAGGGAGGG - Intergenic
1175988624 20:62776735-62776757 CTGTGGAAGGAGGACAGAGGAGG + Intergenic
1176346129 21:5749497-5749519 CTGGGAAAGGAGGAGAGATAAGG + Intergenic
1176352943 21:5870081-5870103 CTGGGAAAGGAGGAGAGATAAGG + Intergenic
1176498698 21:7574958-7574980 CTGGGAAAGGAGGAGAGATAAGG - Intergenic
1176540450 21:8147567-8147589 CTGGGAAAGGAGGAGAGATAAGG + Intergenic
1176559401 21:8330612-8330634 CTGGGAAAGGAGGAGAGATAAGG + Intergenic
1176613491 21:9008339-9008361 CTGGGAAAGGAGGAGAGATGAGG + Intergenic
1177040651 21:16106012-16106034 TTTTGCTAGGAGGAGAGGGATGG - Intergenic
1177341374 21:19805491-19805513 CTGTGAAATCAGGAGAGGACTGG - Intergenic
1178092608 21:29180440-29180462 CTGGGAAAGTAAGAGAGAGAGGG - Intergenic
1178255459 21:31048200-31048222 CAGTGAAAGCAGGAGAAGGCTGG + Intergenic
1178467882 21:32865264-32865286 GTGTTAAAGGAGCAGAGAGAAGG + Intergenic
1178716911 21:34973327-34973349 CTGTGAATGGAGAAGAACGAGGG + Intronic
1178804662 21:35828997-35829019 CTGGGACAGGTGGAGAGAGAGGG + Intronic
1179051924 21:37895755-37895777 CTGTCAGGGCAGGAGAGGGAGGG - Intronic
1179061429 21:37983072-37983094 CTGGGAAAGGAAGGAAGGGAGGG - Intronic
1179243497 21:39611491-39611513 GTGGGAAAGGAGGAAAGGGTGGG + Intronic
1179300362 21:40102927-40102949 GAGTAAAAGGAGTAGAGGGATGG - Intronic
1179417666 21:41211172-41211194 CAGTGAAGGGGGGAGAGGGATGG - Intronic
1179598785 21:42461738-42461760 AGGTGAAAGGAGGAGAGAGGAGG - Intergenic
1179708225 21:43194668-43194690 CTGAGAAATGAGGAGGGGGGAGG - Intergenic
1179826524 21:43969097-43969119 CTCTGGAGGGAGGAGAAGGAGGG - Exonic
1180225164 21:46387774-46387796 CTGTGAGCAGAGTAGAGGGAGGG + Intronic
1180472905 22:15676972-15676994 CAGGGGAAGGAGGAGATGGAAGG - Intergenic
1180685633 22:17664416-17664438 CTGTGAAAGGAGCCGGGGGGGGG - Intronic
1181094585 22:20496480-20496502 ATGGGAGAAGAGGAGAGGGAGGG - Intronic
1181097753 22:20517534-20517556 CTGTGAAAAGAGCAGCGGGGTGG - Intronic
1181148352 22:20864838-20864860 CTGAAAAAGGAGGAGAGAGTTGG + Intronic
1181481925 22:23205377-23205399 CCGTGAGAGGAGGAGAAGGAGGG - Intronic
1181579035 22:23816749-23816771 CTCTGAAATCAGGAGAGGGAAGG - Exonic
1181959200 22:26610785-26610807 CTTTGAAATGGGGAGAAGGATGG - Intronic
1182043900 22:27259530-27259552 CTGTGCAAGGAAGTGAGGGTGGG - Intergenic
1182133217 22:27874423-27874445 CTGTCAAAGGAGGCGAAGGAGGG + Intronic
1182547363 22:31083986-31084008 CTGTAAAATGAAGGGAGGGAGGG + Intronic
1182564182 22:31184922-31184944 CCGTGCAAAGGGGAGAGGGAGGG + Intronic
1182864092 22:33586820-33586842 CTGTGAAAGGAGCAGAGGGAGGG - Intronic
1183032124 22:35114142-35114164 CTGTAAAATGAGGAAAGTGAGGG - Intergenic
1183263929 22:36814195-36814217 CGGTGAGGGGAGGAGAGGGGAGG + Intronic
1183387826 22:37525235-37525257 CTGTGCCAGGAGGTGAGAGATGG + Intergenic
1183395853 22:37570406-37570428 CTGTGAACTGTGGGGAGGGAGGG + Exonic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183732750 22:39627848-39627870 ATGGGGAAGGAAGAGAGGGAAGG + Intronic
1183929440 22:41227657-41227679 CTGGGCAATGAGGAGAGGGCGGG - Intronic
1184048187 22:41985289-41985311 CTGTGAGAGGAGGAGGAGGCTGG - Intronic
1184186131 22:42866535-42866557 CTGTGAAAAGGGGTGGGGGAAGG + Intronic
1184331181 22:43828943-43828965 CTGTAAAAGGAGAGCAGGGAGGG + Intronic
1184345660 22:43911128-43911150 CTGAGAAAGGAGGGAGGGGAGGG - Intergenic
1184519060 22:44981676-44981698 CTCAGAAAGGAGGGGAGGGAGGG + Intronic
1184576758 22:45374839-45374861 CTGTGAAAATAGGGGAAGGAAGG - Intronic
1184831413 22:46991137-46991159 CTGTGAAATGGAGAGAGGAAGGG - Intronic
1184927198 22:47651257-47651279 CTGGGGAAGGAGGAGAAGGTGGG + Intergenic
1184996966 22:48214429-48214451 CCGTGATAGGAGGAGAATGATGG + Intergenic
1185057590 22:48588963-48588985 CTGTAATCGGAGGAGAAGGAAGG - Intronic
1185079092 22:48699834-48699856 CTCTGAGACGGGGAGAGGGAAGG + Intronic
1185191161 22:49437489-49437511 CTCTGAGGGGAAGAGAGGGAGGG - Intronic
1185347196 22:50315768-50315790 TTCTGAGAGGAGGAGAGTGAAGG + Exonic
1185351432 22:50341692-50341714 GTGAGAGAGGAGGAGAGGGCTGG + Intergenic
1203245393 22_KI270733v1_random:63994-64016 CTGGGAAAGGAGGAGAGATAAGG + Intergenic
949127955 3:469118-469140 GTGTGAAAGAGGGAGAGAGATGG - Intergenic
949332504 3:2937835-2937857 CAGAGAGAGGAAGAGAGGGAAGG + Intronic
949389444 3:3543010-3543032 CTGTGAAATGAGGATACAGATGG - Intergenic
949716101 3:6933071-6933093 GTTAGAAAGGAAGAGAGGGAGGG + Intronic
949830597 3:8210254-8210276 CTGTAAAAGGGGCAGAGGGCTGG - Intergenic
950023806 3:9807120-9807142 GTGTGAAAGGAGGGGAGGTGGGG + Intronic
950114768 3:10443612-10443634 AAGTGAAAGTAGGAGAGGGAAGG + Intronic
950321457 3:12058650-12058672 CTGGAACAGGGGGAGAGGGATGG + Intronic
950417913 3:12878994-12879016 CTGGGAAAGGAGGAGAGATAAGG + Intergenic
950708193 3:14796760-14796782 CTGAGAAAGGAGGAGGGAGCTGG - Intergenic
950821022 3:15758650-15758672 CTTTGGAAGGCTGAGAGGGAAGG - Intronic
951677169 3:25254669-25254691 GTGAGAAGGAAGGAGAGGGAGGG + Intronic
951802675 3:26613675-26613697 CTGGGAAGAGAGGAGAGGGATGG + Intergenic
951930137 3:27955941-27955963 CTGTGAAAGAAGGAAAGGAAAGG - Intergenic
952702794 3:36343736-36343758 CTGGAATTGGAGGAGAGGGAAGG + Intergenic
952908497 3:38162983-38163005 TTTTGCAGGGAGGAGAGGGATGG - Intergenic
953044164 3:39280707-39280729 CTGTGAAAGGAGCATAGGCCAGG - Intronic
953052068 3:39353658-39353680 CTGGGAAAGGAGGAGAGATAAGG - Intergenic
953633004 3:44635844-44635866 CAGTGGGAGGAGGAGATGGATGG + Intronic
953755931 3:45645848-45645870 TGGTGAAAGGAGGAGAGAGGAGG - Intronic
953892554 3:46764138-46764160 CTGTGCAAAGAGGAGAGAAAGGG + Intronic
954167836 3:48774835-48774857 CAAAGAAAGGAAGAGAGGGAGGG - Intronic
954250189 3:49361451-49361473 TTGGGAGTGGAGGAGAGGGAAGG + Intronic
954367302 3:50153441-50153463 CTGTGAGAGGATGGAAGGGATGG + Intergenic
954368357 3:50157604-50157626 GGGGGAAAGAAGGAGAGGGAAGG - Intronic
954412463 3:50376798-50376820 CTGTGGAAGGGGGAGAGGTGTGG - Intronic
955997043 3:64688101-64688123 CTCTAAGAGGAGGAGAGGGGAGG + Intergenic
956721025 3:72117594-72117616 CTGTGTAAAGGAGAGAGGGAAGG + Intergenic
956974723 3:74566313-74566335 CTTTGAAGGGAGCAAAGGGAAGG + Intergenic
957267162 3:77982567-77982589 CTGTGAAAGGAGCCGGGGGAGGG - Intergenic
959653347 3:108773022-108773044 CAGAGAAAGGGGGAGAGGAAAGG - Intergenic
959802622 3:110512966-110512988 CTGTGAAAGTGGGAAAAGGAGGG - Intergenic
960390345 3:117070602-117070624 TTGTGAAAGGATGTGAGGCAGGG - Intronic
961323822 3:126097926-126097948 CTGTGTAAGGGGGAGACAGAGGG - Intronic
961373822 3:126449445-126449467 CTGTGAAATGGGGAAAGTGATGG - Intronic
961761282 3:129170308-129170330 GTGTAAAAGGAGGAAAGGGGTGG - Exonic
961795430 3:129405365-129405387 GTGAGAAGGAAGGAGAGGGAAGG + Intronic
962011980 3:131400705-131400727 CTGTGAAAGGGAGAGAAGCAGGG - Intergenic
962345937 3:134619088-134619110 CTGTGGAAGAGGGAGAGGGATGG + Intronic
962404014 3:135084938-135084960 CTGTGAAATGGGGATAAGGAGGG - Intronic
962653377 3:137518149-137518171 GGGAGAAAGGAGAAGAGGGAAGG - Intergenic
962844157 3:139260604-139260626 TTGTGGAAGGAAGGGAGGGAGGG + Intronic
963147407 3:142008425-142008447 CTGTGAAAGGAGGCAGGGGTGGG - Intronic
963219194 3:142788223-142788245 CTGTGGCAGGAGTAGATGGAGGG + Intronic
963677419 3:148330000-148330022 CTAGGCCAGGAGGAGAGGGAGGG - Intergenic
963842236 3:150119612-150119634 ATCTCAAAGGTGGAGAGGGAAGG - Intergenic
963850679 3:150207511-150207533 CTGGAAGAGGAGGAGCGGGAAGG - Intergenic
964914651 3:161825721-161825743 GTTTGATAGGAAGAGAGGGAAGG - Intergenic
965042404 3:163526638-163526660 CTAAGAAAGGAAGAGAGGAAGGG + Intergenic
965311680 3:167135923-167135945 TTGTTTAAGGAGGAGAGGGAAGG + Intergenic
965418809 3:168430715-168430737 CTGTGGAATATGGAGAGGGAGGG + Intergenic
965719103 3:171641683-171641705 ATGTGGAAGCAGGAGAGGAAGGG - Intronic
965772189 3:172193120-172193142 CAGGGAAAGGAAGGGAGGGAGGG - Intronic
965929821 3:174029217-174029239 CTGTGAAAGGAGCTGAGAGGTGG + Intronic
965994400 3:174862292-174862314 CTGTAACAGGAGTAGAGGGAGGG + Intronic
966473606 3:180319813-180319835 CTGGGCAAGGAGGAGTGGGAAGG + Intergenic
966605507 3:181817863-181817885 CTGTGAAAGAAGCAAAGGAAGGG - Intergenic
967085545 3:186091930-186091952 GTGGGAAAGGAAGTGAGGGAAGG + Intronic
967410011 3:189157758-189157780 CTTAGGAAGGAGGACAGGGAGGG - Intronic
967459113 3:189724726-189724748 ATGTGAACAGAGGAGATGGAGGG - Intronic
967874249 3:194256032-194256054 CAGTGTAAGGAGGAGTGTGAGGG - Intergenic
968473118 4:791039-791061 CGGGGACAGGAGGAGAAGGAAGG - Intronic
968480444 4:830792-830814 GTGTCACTGGAGGAGAGGGAGGG - Intergenic
968495366 4:912323-912345 CTGAGAAGGGACGAGAGGGGCGG + Intronic
968729854 4:2264575-2264597 CAATGGCAGGAGGAGAGGGAAGG + Intergenic
968765355 4:2465564-2465586 CTGTGCAGGGAGGGGAGGCAGGG - Intronic
968765379 4:2465636-2465658 CTGTGCAGGGAGGGGAGGCAGGG - Intronic
969101387 4:4771409-4771431 CTTTGAAAGGAGAAGAGTGTGGG + Intergenic
969135111 4:5023045-5023067 CTGTGAAAGACAGAGAGTGAGGG + Intergenic
969593128 4:8133177-8133199 TTGGGAAGGGAGAAGAGGGAAGG - Intronic
969621903 4:8282906-8282928 GTGTGCAAGGAGCAGAGGCATGG + Intronic
969899521 4:10336150-10336172 GTGTGAAAGTGGGAGAGGCAGGG - Intergenic
970251873 4:14125377-14125399 TTCTGAAAGGGGGAGAGAGATGG - Intergenic
970610045 4:17716640-17716662 CTGTTAAACTAGGAGAGGGCTGG - Intronic
971192305 4:24439183-24439205 CTCTTAAAGAAGGAGAAGGATGG - Intergenic
971582296 4:28357280-28357302 ATGGGAAAGGAGGAGAGGGAAGG + Intergenic
971751627 4:30656904-30656926 ATGTGAATGGAGAAGAGGGTGGG + Intergenic
971957222 4:33436753-33436775 CTGTAAACTGAGGAGAGGGCTGG - Intergenic
972562258 4:40239033-40239055 CTGTGGGAGGAGGGGAGGTAGGG - Intronic
972709330 4:41578725-41578747 CTATCAAAGGAGGGGAGGGGAGG - Intronic
972872852 4:43321772-43321794 CTATGAATGGAGGACGGGGATGG - Intergenic
973555919 4:52082950-52082972 ATGTGTATGGAGGGGAGGGATGG + Intronic
973639384 4:52887821-52887843 CTGAGAAAGGAGTTGGGGGATGG - Intronic
973973866 4:56242815-56242837 CTGAGATAGCAGGCGAGGGAGGG + Intronic
974886906 4:67830703-67830725 GAGTGGAAGGAAGAGAGGGAGGG - Intronic
975867414 4:78738095-78738117 AAGGGAAAGGAGGGGAGGGAAGG + Intergenic
977076165 4:92453219-92453241 CTGGGAAAGGAGGGGAGAGAAGG + Intronic
977216136 4:94286147-94286169 CTGTGAAGTGAAGAGAGGTAGGG + Intronic
977836389 4:101650217-101650239 CTGTGAAGTGAGCAGAGGAAGGG - Intronic
977996964 4:103505806-103505828 CTGTGAATGGTGGTGATGGATGG - Intergenic
978119869 4:105065518-105065540 CTGTGAAAGATGAAGAAGGAAGG + Intergenic
978210170 4:106125691-106125713 CTGGGAAAGGTGGACAGGGTGGG + Intronic
978395116 4:108270572-108270594 GTGTGCAAGAAAGAGAGGGAAGG - Intergenic
979099279 4:116595225-116595247 ATGTCAAAGGAGGAGAGAAATGG + Intergenic
979469031 4:121072787-121072809 GTGTGAGAGAAAGAGAGGGAGGG - Intronic
979608830 4:122669161-122669183 GTGTGAGAGGAGGAGAGTGGTGG + Intergenic
979612729 4:122706224-122706246 CTGGGAAGGAAGGAGAGGGAGGG - Intergenic
980397724 4:132236490-132236512 CTTAGAAGAGAGGAGAGGGAAGG + Intergenic
981569072 4:146132381-146132403 CTGGGAAATGAGTACAGGGAGGG + Intergenic
981618991 4:146672692-146672714 CTGGGAAAAAAGCAGAGGGAGGG + Intergenic
981673132 4:147310650-147310672 CAGTGAAAGGAGTCCAGGGAAGG - Intergenic
981728808 4:147875963-147875985 CAGTTAAGGGTGGAGAGGGAGGG - Intronic
981948117 4:150373807-150373829 CAGGGAAAAGAGGAGAGGTAAGG - Intronic
982096474 4:151927846-151927868 CTGTGGAGGGAGGATAGCGAAGG + Intergenic
982427906 4:155287526-155287548 CAGTGACATGTGGAGAGGGAAGG + Intergenic
982954024 4:161739718-161739740 ATGTGAAAGGAGGGGAGGAATGG + Intronic
982974367 4:162035106-162035128 ATGTTAATAGAGGAGAGGGAGGG - Intronic
983352305 4:166606185-166606207 CTGTGAAAGAAAGAAAGGAAAGG + Intergenic
983650079 4:170028348-170028370 CTGTCTAAGGAGGAGGAGGATGG + Intronic
984106029 4:175547074-175547096 GTGTCACAGGAGAAGAGGGAAGG + Intergenic
984370366 4:178856412-178856434 CAGAGACAGGAGGTGAGGGAAGG - Intergenic
984547676 4:181127016-181127038 ATGAGAAAGGAAGGGAGGGAGGG + Intergenic
985011130 4:185583186-185583208 GTGAGAATGGTGGAGAGGGAAGG + Intergenic
985653053 5:1115868-1115890 GTGGGAAGGGAGGAGAGGGAAGG + Intergenic
985956056 5:3267199-3267221 CTGTGAGTGGAGGAAAGGGAGGG + Intergenic
986213630 5:5697981-5698003 CTCAGAAAGGAAAAGAGGGATGG + Intergenic
986291997 5:6407589-6407611 CTCTGGAAGGAGAAGAGGGAAGG - Intergenic
986452738 5:7882288-7882310 CTCTGAAAGGAGGTGTGGGCAGG + Intronic
986468506 5:8050689-8050711 CTGTATAAGAAGGAGAAGGAAGG + Intergenic
986761963 5:10888371-10888393 CTGAGAAATCAGGAGAGAGATGG - Intergenic
987090021 5:14502120-14502142 CTGTGAAAGGAGGCGTGGGGAGG + Intronic
988635619 5:32980504-32980526 GTGTGTATGGAAGAGAGGGAGGG + Intergenic
989161884 5:38399180-38399202 CTATGCTAGGTGGAGAGGGAAGG + Intronic
989624920 5:43420134-43420156 CTGAGGAAGGAGGAGTGGGGCGG - Intergenic
990140277 5:52695249-52695271 CTGAGAAAGGAGATGAAGGAAGG - Intergenic
990247251 5:53875112-53875134 GTGTGAAAGGAGGGGAAGAAAGG - Intergenic
990450725 5:55929676-55929698 CTATGAAATGTGGGGAGGGAGGG - Intergenic
990618445 5:57532473-57532495 AAGTGAAAGAAGGGGAGGGAGGG - Intergenic
991020178 5:61972069-61972091 TTGTGGAAGGAGGTGAGGGAGGG - Intergenic
991128615 5:63095511-63095533 CTCTGAAAAAAGGAGAGGGCAGG - Intergenic
991212406 5:64120870-64120892 CTGAGTAAGGTGAAGAGGGAAGG + Intergenic
991631222 5:68657995-68658017 CTGGGAAAGGGGGAGCAGGAAGG + Intergenic
991650286 5:68845635-68845657 CAAAGCAAGGAGGAGAGGGAAGG + Intergenic
991960058 5:72035354-72035376 CTTTGAAAGAAGGAGGAGGAGGG - Intergenic
991989196 5:72320527-72320549 CTAGGGAAGGAGGGGAGGGATGG + Intronic
992102426 5:73419953-73419975 CCGTGAAAGGAGGGGAGCGAGGG + Intergenic
992440586 5:76794531-76794553 CCGTGGAAGGAAGGGAGGGAGGG - Intergenic
992742672 5:79789998-79790020 TTGTGAAAGGAAGTGAGGAATGG + Intronic
993531571 5:89031166-89031188 CTCTGAAAGGAGTAAGGGGAAGG + Intergenic
993783910 5:92105016-92105038 CTGTGAAAAGAGGGGAGAGTGGG + Intergenic
993809638 5:92459393-92459415 CAGGGGAAGGAGGAGAGGAAGGG - Intergenic
994713084 5:103289840-103289862 CTGAGAAGGGAGAAGATGGAAGG - Intergenic
995402959 5:111762098-111762120 ATGGGAAAGGAAAAGAGGGAAGG + Intronic
995704553 5:114973955-114973977 CAGTTAAAAGAGGAGAGTGAGGG + Intergenic
996322331 5:122232800-122232822 CATGGAAAGGAGGAGAGGTAAGG - Intergenic
996502787 5:124235482-124235504 GAGTGATAGGAGGAGAGGGAAGG + Intergenic
997001193 5:129764197-129764219 CTGTGAAAGAAAGAGAGACATGG + Intronic
997224008 5:132195240-132195262 CTGTGAAGAAAGGACAGGGAGGG - Intronic
997303416 5:132822796-132822818 CTATGTAAGGAGAAGAGGGAAGG + Exonic
997725240 5:136114658-136114680 GTGTGCAGGGAAGAGAGGGAGGG - Intergenic
998044399 5:138974645-138974667 GTATGAAAGCTGGAGAGGGAAGG + Intronic
998184414 5:139967675-139967697 CTATGAAAGGAGAACAGGGCCGG + Intronic
998260000 5:140623204-140623226 CTGGGAAAGGAGGAGAGATAAGG - Intergenic
998422627 5:142001464-142001486 CTGTGAAAGTGGAAGAAGGAAGG + Exonic
999063728 5:148662457-148662479 GAGTGAGAGGAGAAGAGGGAGGG - Intronic
999070474 5:148738675-148738697 CTAGGAAAGGAGGAAAGGGAGGG - Intergenic
999275111 5:150325058-150325080 TTTTGGAAGGAAGAGAGGGAAGG + Intronic
999736582 5:154517599-154517621 ATGTGAAACGAAGTGAGGGAAGG - Intergenic
999828022 5:155292716-155292738 CTATGGAAGGAAGACAGGGAGGG + Intergenic
1000207572 5:159077044-159077066 GAGTGAAAGGGAGAGAGGGAGGG + Intronic
1000946254 5:167427096-167427118 GTGGGGAAGGAAGAGAGGGAGGG + Intronic
1001004606 5:168039079-168039101 TTCTGCAAGGAGGAGAGGCAAGG - Intronic
1001144626 5:169173016-169173038 CTTTGAAAGGCGCAGAGGGGTGG + Intronic
1001312431 5:170620936-170620958 CAGTAAAGGGAGGAGATGGAAGG - Intronic
1001506585 5:172284344-172284366 GTGAGAAAAGAGGAGTGGGAAGG + Intergenic
1002075774 5:176707653-176707675 CTCCGCAAGGAGGAGAGGGATGG + Intergenic
1002704313 5:181149862-181149884 GAGTGAAAGGAAGAGAGAGATGG + Intergenic
1003099530 6:3166509-3166531 ATGTGAAAGGAGGAGGTAGAAGG - Intergenic
1003171057 6:3722498-3722520 ATGTGACAGGAAGAGGGGGAGGG + Intergenic
1003321611 6:5057327-5057349 GTGGGCAGGGAGGAGAGGGAAGG - Intergenic
1003470054 6:6421168-6421190 CTGTGAAATGAGGACTGTGATGG - Intergenic
1003583328 6:7362535-7362557 CTGTGAATGGAGCAGATGGCAGG + Intronic
1003619988 6:7691328-7691350 AGGGGAAGGGAGGAGAGGGAAGG - Intergenic
1003642478 6:7887494-7887516 CTGTGCAGCGCGGAGAGGGAGGG - Intronic
1003707939 6:8555681-8555703 CTCTGTAAGGAGGAGGTGGAGGG - Intergenic
1003954710 6:11151013-11151035 CTGTGAAAAGAGGAGGTGGTGGG - Intergenic
1003957625 6:11178886-11178908 CTATGAAAGGATAAAAGGGAGGG - Intergenic
1004117983 6:12789924-12789946 CAGTGAAAGAAAAAGAGGGAGGG - Intronic
1004789784 6:19012038-19012060 CTCTGAAAGGAGAGGAGGCAAGG + Intergenic
1006095829 6:31656162-31656184 TTGGGAAAGGAAGAGAGGAAGGG + Intronic
1006137303 6:31902752-31902774 CTGAGAATGGAGGGGAGGGCGGG - Intronic
1006389432 6:33749805-33749827 CTGTGAAATGAGGGGAATGATGG - Intergenic
1006389802 6:33751675-33751697 CTGTGAAATGAGGGGAATGATGG - Intergenic
1006463304 6:34176614-34176636 CTGTGACAAGAGCAGAGGCAGGG - Intergenic
1006752953 6:36390685-36390707 CTTTTAAAGGAGGGGAGAGAGGG + Exonic
1006806773 6:36793961-36793983 CCGGGAAAGAAGGGGAGGGAAGG + Intronic
1006847809 6:37074980-37075002 CATTGAATGGAGGAGAGTGAAGG + Intergenic
1007194090 6:40044974-40044996 CTGTTCAGGGAGCAGAGGGAGGG + Intergenic
1007231286 6:40349220-40349242 CCCTGGGAGGAGGAGAGGGAGGG - Intergenic
1007335659 6:41153545-41153567 GTGTGGAAGGGGGAAAGGGATGG + Intronic
1007476807 6:42124560-42124582 GTGGGAAGGGAGGACAGGGAGGG + Intronic
1007831870 6:44645169-44645191 CTGAGACAGGAGCAGAGGAAGGG + Intergenic
1008497208 6:52145468-52145490 ATGGGAGAGGAGGAAAGGGAGGG + Intergenic
1009357722 6:62772279-62772301 CTGGGGATGGAGGAGAGTGAAGG - Intergenic
1009706300 6:67256605-67256627 CTGTGAGAGGGGCAGTGGGAGGG - Intergenic
1010238248 6:73592646-73592668 AGGTGAAAGGAGGAGAGGAGAGG + Intergenic
1010627844 6:78160400-78160422 CTGGGAAAAGAGGAGAGACAAGG - Intergenic
1010656143 6:78514134-78514156 ATGGGACAGCAGGAGAGGGAAGG - Intergenic
1011150924 6:84272421-84272443 GTGTGGCAGGAGGAAAGGGAGGG + Intergenic
1012416493 6:99019249-99019271 CTGTGAGGGGATGAGAGTGAAGG - Intergenic
1012627256 6:101419354-101419376 CTGTGCAAAGAGGCTAGGGAGGG + Intronic
1012638649 6:101580700-101580722 CTGAGAAAGGAAGAGAAAGATGG - Intronic
1012670294 6:102036567-102036589 ATGTGAAAGAAGTAGAGAGAGGG + Intronic
1012707782 6:102555027-102555049 GAGTGAAAGAAGGAGAGAGAGGG + Intergenic
1013176209 6:107679557-107679579 CAGAGAAACAAGGAGAGGGAGGG + Intergenic
1013231953 6:108167800-108167822 GAGTGAAAGGGGGAGGGGGAGGG - Intronic
1013312861 6:108913886-108913908 TTGTTAAATGAGGAGAGAGAAGG - Intronic
1013326877 6:109055170-109055192 GGGTGAAAAGAGGAAAGGGAGGG + Intronic
1013410322 6:109877799-109877821 CTAGGAAAGGAGGAGAGACAAGG - Intergenic
1013490585 6:110642777-110642799 CTTTGATAGGAGGGGAGGGGAGG + Intronic
1013608498 6:111773283-111773305 CTGGGAGAGAAAGAGAGGGAGGG + Intronic
1013640562 6:112073981-112074003 CTTTGAAAGGATGAGATGGGAGG - Intronic
1014268976 6:119314655-119314677 CTGTGCATGGAGGAGCAGGAGGG - Intronic
1014552833 6:122808660-122808682 ATAAGAAAGAAGGAGAGGGAGGG - Intronic
1014703764 6:124721693-124721715 CTGTGAAAGGAAGTGGGGGTGGG - Intronic
1015041687 6:128728158-128728180 CAGAGAAAAGAGGAGAGAGATGG - Intergenic
1015063517 6:128997376-128997398 GAGAGAAAGGAAGAGAGGGAGGG + Intronic
1015137417 6:129889231-129889253 CTGGGAAGAGAGGAAAGGGAAGG - Intergenic
1015591805 6:134829591-134829613 CTGTGAGAGGAGGAAAAGAAGGG + Intergenic
1015923744 6:138290030-138290052 CTGTGGCAGGTGGAGAGGGGTGG + Intronic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1016173863 6:141053705-141053727 TGGGGAAAGGAGGAGAGGGGTGG - Intergenic
1016709465 6:147153402-147153424 GTGTGAAAACAGGAAAGGGAAGG - Intergenic
1016710714 6:147168455-147168477 CTGTGAAAGGAGCAAAGTGGAGG + Intergenic
1017081495 6:150673663-150673685 CTGAAAAAGGAGGAGAGGGAGGG - Intronic
1017124055 6:151049879-151049901 CAGTGCAAGGAGGGCAGGGAAGG - Intronic
1017438736 6:154442772-154442794 CTGTGGAAGGAGCAGAGAGAAGG - Intronic
1017822954 6:158061949-158061971 CGGTGAGGGGAGCAGAGGGAAGG - Intronic
1018212971 6:161499964-161499986 GTGGGGAAGGAGGAGAGTGAGGG - Intronic
1018335173 6:162779025-162779047 CTGTCAGTGGAGCAGAGGGAGGG - Intronic
1018352541 6:162975840-162975862 TTGTGGAAGGAAGGGAGGGAGGG - Intronic
1018853809 6:167661655-167661677 GTGTGGGAGGAGGTGAGGGAAGG - Intergenic
1019026267 6:168966125-168966147 CAGAGAAAAGAGGAGAGGGGAGG - Intergenic
1019164467 6:170088814-170088836 CTGTGAAAGAGGGCGAGGCACGG - Intergenic
1019361564 7:607507-607529 CTGTGAAATGAGGGGAGGAAGGG - Intronic
1019639508 7:2095931-2095953 CTGTGAAGGAAGGAGAGCGCGGG + Intronic
1019651383 7:2161117-2161139 CCGTGCAAAGGGGAGAGGGAGGG - Intronic
1020061617 7:5156722-5156744 ATGAGAAGGGAGGTGAGGGATGG - Intergenic
1020138102 7:5597799-5597821 CTGTGAGGGGAGGACAGGCAGGG + Intronic
1020159949 7:5762929-5762951 TTTTTAAAGGAAGAGAGGGATGG - Intronic
1020166541 7:5811939-5811961 ATGAGAAGGGAGGTGAGGGATGG + Intergenic
1020624279 7:10558439-10558461 AAGGGAAAGGAAGAGAGGGAAGG + Intergenic
1020660490 7:10974956-10974978 CTGGGAAAGGGGAAGAGAGAAGG - Intronic
1020837876 7:13177189-13177211 GTGGGAAAGTAGAAGAGGGACGG - Intergenic
1020944732 7:14588571-14588593 GTAAGAAAGGAAGAGAGGGAGGG - Intronic
1021029594 7:15714773-15714795 GAGAGAAAGGAGGAGAAGGAGGG + Intergenic
1021049408 7:15964256-15964278 CTGTCAAAGGAGAAAAGAGATGG + Intergenic
1022322203 7:29297824-29297846 CTGTGAAAAGAGGACAGGGGAGG + Intronic
1022454846 7:30549411-30549433 CTGTAAAATGAGGAGAATGATGG + Intronic
1022498732 7:30869295-30869317 CTGATAGAGGAGGAGAAGGATGG + Intronic
1022776156 7:33529598-33529620 ATGGGAGAGGAGGGGAGGGAAGG - Intronic
1023288770 7:38647031-38647053 GAGAGAAAGGAGGGGAGGGAGGG - Intergenic
1023991691 7:45132553-45132575 GGGAGGAAGGAGGAGAGGGAGGG + Intergenic
1024322613 7:48086029-48086051 CTCTGAGAGGTGGGGAGGGAAGG - Intergenic
1024444941 7:49466146-49466168 CAGTGTTAGGAGCAGAGGGAAGG + Intergenic
1024497288 7:50063169-50063191 CTGGGAAGGGAGGAGAGATAAGG + Intronic
1024498155 7:50070916-50070938 CTGGGAAAGGGGGAGAGATAAGG + Intronic
1024522144 7:50314922-50314944 GTGTGGAAGGAGGAAAGGCAGGG + Intronic
1024697718 7:51873380-51873402 ATGTAATAGGGGGAGAGGGAAGG + Intergenic
1024785070 7:52898158-52898180 GAGAGAAAGGAGGAGAGGGAGGG + Intergenic
1025613206 7:63096234-63096256 CTGGGCAAGGTGGAGAGGGGAGG + Intergenic
1025930813 7:65992514-65992536 CTGGGAAAGGAGGAGTGATAAGG - Intergenic
1025942143 7:66082484-66082506 CTGGGCAAGGTGGAGAGGGGAGG - Intronic
1026095685 7:67344727-67344749 CTATGGAAGGAAGAGAGGAATGG + Intergenic
1026155032 7:67818973-67818995 AAGGGAAGGGAGGAGAGGGAGGG - Intergenic
1026269601 7:68824617-68824639 CTGGGAAGGGAGGAGAGATAAGG + Intergenic
1026812974 7:73484258-73484280 CTGTCAAAGGAAGGAAGGGAGGG + Intronic
1026946543 7:74319862-74319884 GTGTGAAAAGAGGTTAGGGAGGG + Intronic
1027172894 7:75885401-75885423 CTGGGAACAGGGGAGAGGGAGGG - Intronic
1027229784 7:76265425-76265447 CTGTAGTGGGAGGAGAGGGAGGG - Exonic
1027539357 7:79449254-79449276 CTTTGAAAGGAGCAGTAGGAGGG + Intronic
1027581000 7:79995662-79995684 GTGTGGTAGGGGGAGAGGGAAGG - Intergenic
1028222993 7:88219094-88219116 GTGTGAATGGAAGAGAGGGGTGG - Intronic
1028750595 7:94378143-94378165 AAGTCAAAGGAGGAGAGGGAAGG + Intergenic
1029117482 7:98244747-98244769 CTGGGGAAGGTGGGGAGGGAGGG + Intronic
1029328766 7:99833505-99833527 CTGGGAAGGGAGGAGAGATAAGG + Intronic
1029412850 7:100426865-100426887 CAGGGAAGGGAGGAGGGGGAGGG - Intronic
1029584764 7:101463483-101463505 AAGGGAAAGGAGGGGAGGGAAGG - Intronic
1030118573 7:106083591-106083613 CTCTGAAAGGCGGAGATGAAGGG + Intergenic
1030384292 7:108848730-108848752 GAGAGAAAGGAGGAGAGGGGAGG - Intergenic
1030625544 7:111842185-111842207 CTCTGACAGGAGGGGAGAGAGGG + Intronic
1030738305 7:113077617-113077639 CTGTGAAAGTGGGAGCAGGAAGG - Intergenic
1031417581 7:121511246-121511268 CTGTAAGAGGAGGAGGGGGTAGG + Intergenic
1031514706 7:122687671-122687693 GTGTGATAGGAATAGAGGGAGGG - Intronic
1032199543 7:129809712-129809734 CTTTGAGAGGCCGAGAGGGAAGG + Intergenic
1033024459 7:137759101-137759123 CTGAGGGAGTAGGAGAGGGAGGG - Intronic
1033983968 7:147200063-147200085 GTGAGAAAGGAGGAGGGGGAGGG - Intronic
1034836854 7:154360356-154360378 CTGTGAAAGGAAGAAATTGAAGG - Intronic
1035194677 7:157206823-157206845 CTGTGAAAGCAGGAGCAGGATGG + Intronic
1035229824 7:157458292-157458314 CAGAGAAAGGAGGAGAGCGGTGG + Intergenic
1035261386 7:157663640-157663662 CAGGGAAGGGTGGAGAGGGAGGG - Intronic
1035274757 7:157741112-157741134 CTGTGGAAGGAGGCGTGGGGTGG - Intronic
1035555661 8:565504-565526 CAGTGGGAGGACGAGAGGGAGGG - Intergenic
1035559253 8:592978-593000 CTGTGATAGGAGGGCAGTGAGGG + Intergenic
1035753515 8:2012305-2012327 CAGTGACAGGAGGAGAGGGAAGG + Intergenic
1036095142 8:5715787-5715809 CTGTGAAAGCAAGGGAAGGAGGG + Intergenic
1036426495 8:8649677-8649699 CTGGGAAAGGAGGCGAGCAAGGG - Intergenic
1036546985 8:9781226-9781248 CTTTGAAAGGATGGGAGGTAGGG - Exonic
1036621229 8:10425433-10425455 CTGCGAAGGGAGGAGGAGGAGGG + Intronic
1036631509 8:10519111-10519133 CTGTGGGAGGAGCAGAGGGGAGG - Intergenic
1036638151 8:10565356-10565378 CTGTGAAAGAAGGGGAGGCCAGG + Intergenic
1036719100 8:11156152-11156174 CAGTAAAAGGTGAAGAGGGAAGG - Intronic
1037185841 8:16062824-16062846 GGGTGAGAGGAAGAGAGGGAGGG + Intergenic
1037240643 8:16773395-16773417 CTGGGTAAGGAGGGAAGGGAGGG - Intergenic
1037365904 8:18122067-18122089 CAGCCAAAGCAGGAGAGGGATGG - Intergenic
1037400318 8:18489165-18489187 AGGTGAGAGGAGGAGAGGGGAGG + Intergenic
1037459547 8:19095214-19095236 CCGTGTAAGTAGGAGAGGAAAGG + Intergenic
1037571774 8:20164192-20164214 CTGAGGAAAGAGGACAGGGAAGG - Intronic
1038171199 8:25134458-25134480 ATGGGAAAGGTGGACAGGGAAGG + Intergenic
1038398534 8:27265475-27265497 GTGAGAAAGAAGGAAAGGGAGGG - Intergenic
1038677910 8:29640211-29640233 CTGAAGAAGGAGGATAGGGAAGG + Intergenic
1039409692 8:37342366-37342388 GTGGGAAAGGGGGACAGGGAGGG + Intergenic
1039483138 8:37890388-37890410 CTTTGAATGGAGTAGAGGGAAGG - Intronic
1039611721 8:38924428-38924450 CTGGGGAAGGAGGACAGGGAAGG + Intronic
1039658827 8:39439604-39439626 CTGTGAAGGGAAGGAAGGGAAGG - Intergenic
1039666380 8:39535602-39535624 CTGGGAAAGGAGGAGAGATAAGG - Intergenic
1040900510 8:52412952-52412974 TTTTTAAAGGAGGAGAGAGATGG - Intronic
1041091910 8:54309933-54309955 CTGTGAGGGGAAGAGAAGGAAGG - Intergenic
1041230731 8:55748540-55748562 GTGTGCAAGGGAGAGAGGGAGGG + Intronic
1041237673 8:55820854-55820876 TTGTGAGAGGAAGAGAGGGTAGG - Intronic
1041700318 8:60781501-60781523 CTATGAAATGAGGGGTGGGAGGG + Intronic
1041735948 8:61110344-61110366 CTCAAAAAGGAAGAGAGGGAAGG - Intronic
1042734049 8:71968028-71968050 TTGTGAAAGTAGGAGAGAGAAGG + Intronic
1042819835 8:72917941-72917963 GTGTGAAAGGTGTAGAGAGAAGG + Intronic
1043057213 8:75454057-75454079 GGGAGAAAGGAAGAGAGGGAGGG - Intronic
1043057222 8:75454085-75454107 GGGAGAAAGGAAGAGAGGGAGGG - Intronic
1043092450 8:75923592-75923614 CTTTGAAAGAAGTAGAGGAAGGG + Intergenic
1043096209 8:75977245-75977267 TTGTGTAAGGAGCAGAGGCAGGG + Intergenic
1044068204 8:87723663-87723685 GAGAGAAAGGAGGAGAGAGAGGG + Intergenic
1044109854 8:88259020-88259042 TGGTGAAAGGAGGAAAGGAAAGG - Intronic
1044537201 8:93370852-93370874 AGGTGGAAAGAGGAGAGGGAAGG + Intergenic
1044656506 8:94553782-94553804 CGGTGGATGGAGGAGGGGGAGGG + Intergenic
1044772553 8:95652442-95652464 GTGAGAAAGAAGGAGTGGGATGG - Intergenic
1044986602 8:97761509-97761531 GTGTCAAAGGTGGAGAAGGAAGG - Intergenic
1045001285 8:97880415-97880437 CTGGGAGAGGAGGAGAGATAAGG - Intronic
1045252184 8:100491464-100491486 CTGGGACTGCAGGAGAGGGATGG + Intergenic
1045425050 8:102057758-102057780 CTGGGAAAGGATAAGAGGAAAGG - Intronic
1046301169 8:112292719-112292741 ATGTGGCAGGAGGACAGGGAAGG + Intronic
1046366620 8:113240155-113240177 CTTTGAAAGGAGGACATGGATGG - Intronic
1046771000 8:118116438-118116460 CGGTGAGGGGAGGTGAGGGACGG - Intergenic
1046861083 8:119092443-119092465 TTCTGAGAGGAGGACAGGGAAGG - Intronic
1046967492 8:120183862-120183884 CGGAGAAAGGAAGGGAGGGAGGG - Intronic
1047187375 8:122646123-122646145 CTGGGATTGGAGGAGAGGGTAGG - Intergenic
1047235086 8:123034023-123034045 CTGTCAAAGGAAGAAAGGGTTGG + Intronic
1047432552 8:124805412-124805434 CAGAGGAAGCAGGAGAGGGAAGG + Intergenic
1047489596 8:125363595-125363617 AGGAGAAAGGAGGAGGGGGAGGG + Intronic
1047782713 8:128123138-128123160 CTGTGGGAGGAGGAAAGGGCTGG - Intergenic
1047869731 8:129069699-129069721 CTGGGATATTAGGAGAGGGAGGG - Intergenic
1048050331 8:130810294-130810316 ATGTGAAAGGGTGACAGGGAAGG - Intronic
1048340329 8:133533715-133533737 CTGTGAAATTAGGAGTGGAAGGG - Intronic
1048360512 8:133693614-133693636 CTGAGAAAGGAGGAGAAGAGTGG + Intergenic
1048496745 8:134942011-134942033 CTGGGAAAGCAGGAGCTGGAGGG - Intergenic
1048798652 8:138175273-138175295 ATGAGAAAGTAGGAGAGGGGAGG - Intronic
1048951530 8:139500876-139500898 TTGTGAATGGAGGAGGAGGAAGG + Intergenic
1049132055 8:140854886-140854908 CCATGAAAAGAAGAGAGGGAGGG - Intronic
1049239581 8:141530419-141530441 CTGTGAAAGGAAGAGACGGGTGG - Intergenic
1049440448 8:142607199-142607221 AAGTGAAGGGAGGGGAGGGAAGG + Intergenic
1049468823 8:142766115-142766137 CTGGGAAAGGAGGAGAGAGAAGG - Intronic
1050181537 9:2928175-2928197 GAATGAAGGGAGGAGAGGGAGGG + Intergenic
1050459314 9:5863626-5863648 CTATGTAAGGATCAGAGGGAAGG + Intergenic
1050536455 9:6634837-6634859 CTGAGATCAGAGGAGAGGGAGGG - Intronic
1050978371 9:11972730-11972752 CTTGGAAAGAAGGAGATGGATGG - Intergenic
1051275388 9:15393495-15393517 GTAAGAAAGGAAGAGAGGGAGGG - Intergenic
1051345183 9:16144971-16144993 CAGTGAAAGGAGGAGGCTGATGG - Intergenic
1051501792 9:17786082-17786104 CAGTGAAGGGAGGATGGGGAAGG + Intronic
1051604765 9:18908419-18908441 CTGGGAAAGGAGGACGGGGTCGG - Intronic
1052781327 9:32783863-32783885 TAGTGAGAGGAAGAGAGGGAGGG + Intronic
1053294890 9:36905693-36905715 CTGAGAAAGGAGGATAGGAGAGG + Intronic
1053462133 9:38279228-38279250 GAGTGGAAGCAGGAGAGGGAGGG - Intergenic
1053484748 9:38443259-38443281 CTGGGAGAGGAGAAGTGGGAGGG + Intergenic
1054735636 9:68747066-68747088 CAGGGAAAGAATGAGAGGGAAGG - Intronic
1054739466 9:68790063-68790085 AGGGGAAAGGAGGGGAGGGAAGG - Intronic
1054865113 9:69992072-69992094 CTCAGAAAGGGGGAGAGTGAGGG + Intergenic
1055013144 9:71589212-71589234 GTGAGAAAGGAAGGGAGGGAAGG + Intergenic
1055612789 9:78040369-78040391 CTGTGAATGAATGAAAGGGAAGG - Intergenic
1055680849 9:78713631-78713653 AAGGGAAAGGGGGAGAGGGAAGG + Intergenic
1055896180 9:81178515-81178537 CTGCGGTAAGAGGAGAGGGAAGG - Intergenic
1056286414 9:85091845-85091867 CTGTGAAGGGAAGAGAAAGATGG + Intergenic
1056305134 9:85283063-85283085 CGTTGAAAGGATGAGTGGGAGGG - Intergenic
1056320622 9:85431382-85431404 CAGGGAAGGAAGGAGAGGGATGG - Intergenic
1056513629 9:87329454-87329476 ATAGGAAAGGAGGAGAAGGAAGG - Intergenic
1056618295 9:88187556-88187578 CTCTGAAAGAAGGAAAGGGGAGG + Intergenic
1057345444 9:94246747-94246769 CTGTGGAAGGAGGAGGGATAAGG - Intergenic
1057477963 9:95420676-95420698 CTGTGACAGAAGGAGAGGGAGGG - Intergenic
1057519720 9:95751575-95751597 CTGTGGAAGGGAGGGAGGGAGGG + Intergenic
1057747990 9:97766942-97766964 CTAAGAAAGGAGGATAGGAAAGG + Intergenic
1057920886 9:99095656-99095678 CTGTGTAATGGGGAGGGGGAAGG - Intergenic
1058201291 9:102044829-102044851 CTGGGAAAGGTGGTGTGGGAAGG - Intergenic
1058815016 9:108675099-108675121 GTGAGGAAGGAGCAGAGGGAAGG - Intergenic
1059282778 9:113149143-113149165 CCGTGAAAGGAGGGGAGTCATGG + Intergenic
1059667346 9:116461087-116461109 ATGGAAAAGGAGGTGAGGGAAGG - Intronic
1060484888 9:124040828-124040850 CCTTGAAAAGAGGAGAGGGAGGG + Intergenic
1060798201 9:126526763-126526785 CTGGGGCAGGAGGAGAGGAAAGG - Intergenic
1060952481 9:127612752-127612774 GGGTGAAGGGAAGAGAGGGAGGG - Intronic
1061081461 9:128373197-128373219 CTGTGACAGGAGGTGATAGAAGG - Intronic
1061378974 9:130242938-130242960 ATGGGCAAGGAGGAGAGGCAAGG + Intergenic
1061533770 9:131235040-131235062 CTGTGCAGTTAGGAGAGGGAGGG + Intergenic
1061544565 9:131297027-131297049 CTGAGAAAGGAGGCTGGGGAGGG - Intronic
1061699388 9:132404478-132404500 CTGAGAAGGCAGGAGAGGGTTGG - Intronic
1061933143 9:133843649-133843671 ATGTGAAGGAAGGAGGGGGAAGG + Intronic
1061942617 9:133891599-133891621 AGGGGAAAGAAGGAGAGGGATGG + Intronic
1061947715 9:133917994-133918016 CTGTGGAAGGAGGTCAGTGAAGG - Intronic
1061967567 9:134025020-134025042 CTGGGAAAGGAGGAGGGGCTGGG - Intergenic
1203461730 Un_GL000220v1:47066-47088 CTGGGAAAGGAGGAGAGATAAGG + Intergenic
1203581738 Un_KI270746v1:13122-13144 CGGTAAAAGGAGGAAAGGAAGGG + Intergenic
1185553640 X:1003344-1003366 GTGTGGCAGGAGGAGAGAGAAGG + Intergenic
1185890426 X:3817024-3817046 CTCTAAAAAGAGGAGAAGGAGGG - Intergenic
1186232572 X:7471853-7471875 CTGTCAGAGGACAAGAGGGAGGG + Intergenic
1186428494 X:9484421-9484443 CTGGGAAAGGGGTAGAGGGAGGG - Intronic
1187023826 X:15411781-15411803 TGGTGGAAGGAGGAGCGGGAGGG - Intronic
1187254504 X:17629988-17630010 CTGTCAAGGGAGAAGAGAGAGGG + Intronic
1187522071 X:20022534-20022556 CTGAGGAAGGAGAGGAGGGACGG + Intronic
1187555540 X:20347858-20347880 CTGTGAAAGCAGAGGAGGAAGGG - Intergenic
1187694494 X:21905177-21905199 CTTGGAAAGGAGCAGAGGAAGGG - Intergenic
1187699717 X:21953478-21953500 CTGGGAAAGGAGGAGAGATAAGG + Intronic
1187946718 X:24433383-24433405 CTAGGAAAGGAGGAGAGATAAGG + Intergenic
1188197276 X:27251926-27251948 CTCTGAAAGGTGGAAAGAGAAGG - Intergenic
1188558429 X:31439185-31439207 CTGAGAAAGGATGAGAGGGGTGG + Intronic
1188574594 X:31631621-31631643 CTGTGAGCGGAGGAAAGGAAAGG - Intronic
1188612546 X:32118080-32118102 CTTTGAATGTAGGAGAGGCATGG - Intronic
1189431760 X:40953217-40953239 CTGTGAAAGGAGTTCAAGGATGG - Intergenic
1189664861 X:43343333-43343355 CTATACCAGGAGGAGAGGGAAGG + Intergenic
1189700551 X:43714087-43714109 GTGTCAAAGGGAGAGAGGGAAGG + Intronic
1190055765 X:47180189-47180211 CTGTGGGAGGAGGGGAGGCAGGG - Intronic
1190136900 X:47806247-47806269 CTGGGAAAAGTGGGGAGGGAGGG - Intergenic
1190322930 X:49188964-49188986 ATCTAAAAGGAGGACAGGGAGGG - Exonic
1190713286 X:53084484-53084506 CCGTGAAAGGGAGGGAGGGAAGG - Intronic
1191143855 X:57144667-57144689 CTTGGAAAGGATGAGAGGGAGGG - Intergenic
1192056521 X:67779329-67779351 CTGTGAAGGCAGGCCAGGGAGGG + Intergenic
1192192418 X:68999452-68999474 CGGTGGGAGGAGGAGAGGGGTGG + Intergenic
1192844496 X:74891874-74891896 CTGTGAAAGGGTGAGGGGAAAGG - Intronic
1192985198 X:76391723-76391745 GTGAGGTAGGAGGAGAGGGAGGG - Intergenic
1195202749 X:102565629-102565651 GAGTGAGAGGGGGAGAGGGAGGG + Intergenic
1195543616 X:106090054-106090076 CATGGAAAGGAGGAGAGGGAAGG - Intergenic
1196263657 X:113615864-113615886 CTCTGGTAGGAGGAGAGGAAAGG - Intergenic
1196793610 X:119485542-119485564 TTGTGGAAGGAAGGGAGGGAGGG + Intergenic
1196867120 X:120080238-120080260 CTGGGAAAGGAGGAGAGATAAGG + Intergenic
1196874626 X:120146541-120146563 CTGGGAAAGGAGGAGAGATAAGG - Intergenic
1196875979 X:120156044-120156066 CTGGGAAAGGAGGAGAGATAAGG - Intergenic
1196883904 X:120224602-120224624 CTGGGAAGGGAGGAGAGATAAGG + Intergenic
1196928705 X:120660065-120660087 GTGTAAAAGGAGGAGAGAGAGGG + Intergenic
1197213980 X:123851106-123851128 TTGTGGGAGGAAGAGAGGGAAGG - Intergenic
1197710985 X:129667096-129667118 CTGGGGATGGAGGAGAGGGGAGG + Intergenic
1197770838 X:130088265-130088287 CTGTGAGTGGAGGAGATGGAGGG + Intronic
1198219484 X:134586529-134586551 CCGTGAAAGGAAGAGTGGTAGGG + Intronic
1198322598 X:135533544-135533566 CTGTGAATGGGGGTGGGGGAAGG - Intronic
1198706172 X:139450819-139450841 AAGAAAAAGGAGGAGAGGGAAGG + Intergenic
1199403221 X:147425048-147425070 TTGTGAAAGCAAGAGAGGGTGGG + Intergenic
1199709599 X:150459817-150459839 ATAAGAAAGGAAGAGAGGGAGGG + Intronic
1199849869 X:151717840-151717862 CTCTGAGAGGAGGAGGCGGACGG + Intronic
1199904955 X:152216635-152216657 CTGGGGAAGGAGAAGAGAGAGGG + Intronic
1199944747 X:152656271-152656293 GTGTGAGGTGAGGAGAGGGATGG - Exonic
1200256022 X:154583968-154583990 CTGGGAAAGGTGGGGAGGGTGGG - Intergenic
1200261747 X:154620435-154620457 CTGGGAAAGGTGGGGAGGGTGGG + Intergenic
1200305558 X:155022864-155022886 TAAGGAAAGGAGGAGAGGGATGG + Intronic
1200311863 X:155086371-155086393 CTGGGCAAGGAAGGGAGGGAGGG - Intronic
1200319622 X:155173725-155173747 CTGGGAAAGGAGGAGAGATAAGG + Intergenic
1201550525 Y:15212493-15212515 AGGTGAAAGAAAGAGAGGGAGGG + Intergenic
1201644441 Y:16213732-16213754 CTGGGAAAGTAGGAGAGATAAGG + Intergenic
1201658374 Y:16371589-16371611 CTGGGAAAGTAGGAGAGATAAGG - Intergenic