ID: 905378118

View in Genome Browser
Species Human (GRCh38)
Location 1:37538872-37538894
Sequence CTGAAAATATAGATGAAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 730
Summary {0: 1, 1: 0, 2: 7, 3: 90, 4: 632}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905378118 Original CRISPR CTGAAAATATAGATGAAGTT TGG (reversed) Intronic
900766626 1:4510166-4510188 CTGAAAATACAGAGGAATTTAGG + Intergenic
900811906 1:4809818-4809840 TTGAATCTATAGATCAAGTTGGG - Intergenic
901313188 1:8285560-8285582 TTGAAAATAAGGATGAGGTTGGG + Intergenic
901585014 1:10282903-10282925 CTGTTAATAAAGATGAAGTTTGG + Intronic
902638647 1:17751660-17751682 CTGAAAAGCTAGGTGAACTTGGG - Intergenic
903644169 1:24882350-24882372 CTGAATCTATAGATCAGGTTGGG + Intergenic
904217385 1:28932578-28932600 CTGAAAATATATAACTAGTTTGG - Intronic
904646238 1:31968852-31968874 CTGAAAATGTAGATCAGTTTGGG - Intergenic
904724543 1:32537196-32537218 ATGAGAATATTGATGAAGTGGGG - Intronic
904985295 1:34542314-34542336 TTGAATCTATAGATTAAGTTGGG - Intergenic
905295031 1:36948842-36948864 CTAAAAATATAGCTAAGGTTTGG + Intronic
905378118 1:37538872-37538894 CTGAAAATATAGATGAAGTTTGG - Intronic
905784945 1:40747819-40747841 TTGAAAAAATAGTTGATGTTGGG + Intronic
905845836 1:41230704-41230726 CTGAACAAATAGATGAATTAGGG + Intronic
906951609 1:50339054-50339076 TTGAATCTATAGATCAAGTTAGG + Intergenic
907728165 1:57039734-57039756 TTGAAAATATACATGAGGTTGGG + Intronic
908345856 1:63231964-63231986 CAGAAAATCTAGATGACTTTGGG - Intergenic
908661291 1:66438264-66438286 CTGCTATTATAGATGCAGTTAGG - Intergenic
908793613 1:67808866-67808888 CTGAATCTATAGGTCAAGTTAGG - Intronic
908877429 1:68693884-68693906 CTGATAATAAAGATGGACTTAGG + Intergenic
910342861 1:86207974-86207996 CAGATAATATGGATGAAGCTGGG + Intergenic
910412321 1:86959867-86959889 CTGAATCTATAGATCACGTTGGG - Intronic
910816484 1:91296592-91296614 CTGAATATAAAGATTAATTTGGG + Intronic
910839077 1:91544704-91544726 CTGAAACTATAGTTTAATTTGGG + Intergenic
911436983 1:97872981-97873003 CTGAAAATAAAGATGAAGGAGGG - Intronic
911767508 1:101695761-101695783 CTGAAAATAAAGAGGATGTAAGG - Intergenic
911840168 1:102672334-102672356 TTGAAAATATAGAACAAATTAGG - Intergenic
912065690 1:105738797-105738819 AGGAAAATTTAGGTGAAGTTTGG - Intergenic
912536565 1:110377680-110377702 TTGAAAATATGTAGGAAGTTTGG + Intronic
913348818 1:117835155-117835177 CAGAAAGTATACATTAAGTTGGG + Intergenic
913664986 1:121039546-121039568 CTGAAAATCTAGATGACCTTGGG + Intergenic
914016378 1:143822820-143822842 CTGAAAATCTAGATGACCTTGGG + Intergenic
914161406 1:145138181-145138203 CTGAAAATCTAGATGACCTTGGG - Intergenic
914654995 1:149731361-149731383 CTGAAAATCTAGATGACCTTGGG + Intergenic
914699051 1:150114059-150114081 CTGAAAATAATGATTAATTTGGG - Intronic
914815865 1:151061612-151061634 ATGTAAAGATAGATGAAGTAGGG + Intronic
914816264 1:151064995-151065017 ATGTAAAGATAGATGAAGTAGGG + Intronic
914895203 1:151664588-151664610 CTGAAAATTCTGATCAAGTTAGG - Intronic
915626158 1:157115237-157115259 CTCAGAATATATATAAAGTTTGG - Intergenic
916087219 1:161280200-161280222 TTCAAAATATAGAAGCAGTTAGG + Intronic
916865447 1:168851508-168851530 GTGAAAATGTAGGTGAAGTTAGG + Intergenic
917129330 1:171724645-171724667 TTGAACCTATAGATGAATTTGGG - Intronic
917157129 1:172015334-172015356 TTGAATCTATAGATTAAGTTGGG + Intronic
917568572 1:176237710-176237732 CTGAATCTATAGATCATGTTAGG + Intergenic
918173133 1:182017484-182017506 GTGACAATATAGATGGAATTGGG - Intergenic
918484531 1:185015301-185015323 CTGGAAATACAGATGCAGATTGG - Intergenic
918539895 1:185619727-185619749 ATGAATCTATAGATCAAGTTGGG + Intergenic
918615013 1:186534139-186534161 CTGGAAATATAAATGAGATTGGG + Intergenic
918665658 1:187147259-187147281 TTGAATCTATAGATCAAGTTGGG + Intergenic
919127408 1:193412158-193412180 TAGCAAATATAGATGAAGATGGG - Intergenic
919881099 1:201901206-201901228 TTAAAAATATACATGAAGTCCGG + Intronic
920510402 1:206547315-206547337 CTGTAAATACAGATGAAGCGTGG - Intronic
920836823 1:209518853-209518875 CTGAAAGTATAGAAGCAGCTTGG + Intergenic
920926941 1:210350342-210350364 TTGAATCTATAGATTAAGTTGGG + Intronic
921584668 1:216932912-216932934 TTGAAAATATAGATACACTTTGG + Intronic
921695541 1:218204899-218204921 TTGGAAATACAGAAGAAGTTTGG - Intergenic
922656021 1:227384206-227384228 TTGAATTTATAGATCAAGTTAGG - Intergenic
923059840 1:230461338-230461360 TTGAATCTATAGATCAAGTTAGG - Intergenic
923429043 1:233903278-233903300 TTGAATCTATAGATGAAGTTGGG + Intergenic
923818635 1:237408745-237408767 TTGAAACTATAGATCAAATTGGG + Intronic
1063350914 10:5354173-5354195 CTGAATAGATTGGTGAAGTTAGG - Intergenic
1063506157 10:6601597-6601619 CTGTGAACACAGATGAAGTTTGG + Intergenic
1063724978 10:8627008-8627030 GTGAAAACAGAGATGAAATTGGG - Intergenic
1063892252 10:10642644-10642666 ATGAAAATATGGAGGAATTTTGG + Intergenic
1064789998 10:18947098-18947120 GGGAAAATATAGATGACCTTGGG - Intergenic
1066219870 10:33325212-33325234 TGGAAAATAGAGATGTAGTTTGG + Intronic
1066225882 10:33382859-33382881 CAAAAAATATAGATGAAATTTGG + Intergenic
1066519659 10:36201809-36201831 CTGAATCTACAGATCAAGTTGGG + Intergenic
1066533770 10:36367987-36368009 CTGGAAATAAAGATGAAGAAGGG + Intergenic
1068266875 10:54661603-54661625 CTAAGAAGAAAGATGAAGTTGGG + Intronic
1068726945 10:60313690-60313712 CTGTAAATATTGAGGATGTTAGG - Intronic
1068925489 10:62531865-62531887 TTTAAAATATAGATGATGATTGG + Intronic
1069022891 10:63508547-63508569 TTGAATCTATAGATCAAGTTGGG + Intergenic
1069154287 10:65006192-65006214 CTGAATCTATAGATCAAGTTGGG + Intergenic
1069644594 10:69984205-69984227 CTGAATATACAAATCAAGTTAGG - Intergenic
1070897623 10:79998398-79998420 TGGAAAATATAGATGAGGCTGGG - Intergenic
1071441350 10:85699570-85699592 CTGAAAATTTAGATGACCGTGGG - Intronic
1072173362 10:92890037-92890059 TTGAATCTATAGATGAAGTTGGG + Intronic
1073838736 10:107473913-107473935 CTGAAAATGTAGAAGTAGGTAGG + Intergenic
1074263724 10:111880329-111880351 TTTGAAATATAGATGAAGTAAGG - Intergenic
1074918945 10:117987602-117987624 GTGAAAATGAAGATGAAATTAGG - Intergenic
1075267613 10:121016988-121017010 ATGAAAATCTAGATGACCTTGGG + Intergenic
1075501210 10:122976353-122976375 TTGAATCTATAGATCAAGTTGGG - Intronic
1076132706 10:128024992-128025014 CAAAAAATATAAATGAAATTAGG + Intronic
1076633076 10:131864037-131864059 TTGAACCTATAGATCAAGTTGGG - Intergenic
1076703560 10:132287785-132287807 CTGAAACTATAGATCAATTCAGG - Intronic
1076775598 10:132696258-132696280 TTGAATCTATAGCTGAAGTTGGG - Intronic
1076815621 10:132913388-132913410 CTGTAAATGCAGATGGAGTTTGG - Intronic
1076918271 10:133437211-133437233 TTGAAAATATCAATGAAATTGGG - Intergenic
1077058338 11:606683-606705 CGGAAGATGTAGCTGAAGTTGGG + Intronic
1077778370 11:5296453-5296475 TTTAAAATATAAATGAAGGTAGG - Intronic
1077901205 11:6490472-6490494 GTGAATATATAGATGAATGTGGG - Intronic
1077951898 11:6968352-6968374 CTGAATATATAAATTACGTTGGG + Intronic
1079019651 11:16899000-16899022 TTGAATATATAGATTAATTTAGG - Intronic
1080530540 11:33171191-33171213 TTGAAACTATAGATCAATTTGGG - Intergenic
1080533824 11:33202285-33202307 CTGAATCTATAAATGAGGTTGGG + Intergenic
1080564572 11:33496328-33496350 CTGATAATATCTATGAAGGTAGG + Intergenic
1081016268 11:37885419-37885441 CTGAAATTATACCTGAAATTTGG - Intergenic
1081204163 11:40255487-40255509 CAGAAATTATAAATAAAGTTTGG - Intronic
1081267111 11:41038395-41038417 TTGAAAATGTAAATGAGGTTAGG - Intronic
1081821102 11:45995897-45995919 CTGAAAATAATAATGAATTTGGG - Intronic
1081839761 11:46190584-46190606 CTGAATCTATAAATCAAGTTGGG - Intergenic
1082246878 11:49933888-49933910 ATGAATGTATAGATAAAGTTGGG - Intergenic
1082286200 11:50320752-50320774 CTGAAAATATTGCTAAAGGTTGG - Intergenic
1082711609 11:56559965-56559987 CGGCAAATTTAGATGAAATTTGG - Intergenic
1083378189 11:62243253-62243275 ATAAAAATATAGTTGATGTTAGG - Intronic
1084015493 11:66377787-66377809 CTTAATCTATAGATCAAGTTGGG + Intergenic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1084471673 11:69364849-69364871 CTGAAAATGTAAATGAAATGAGG + Intronic
1085099947 11:73792051-73792073 CTAAAATTTGAGATGAAGTTAGG - Intronic
1085875258 11:80399580-80399602 CTGACATTCTAGATGAAATTTGG - Intergenic
1085928222 11:81047993-81048015 GTGTATATATATATGAAGTTTGG - Intergenic
1085935936 11:81142919-81142941 CTGAAAATATTTATATAGTTAGG + Intergenic
1085938617 11:81180921-81180943 TTGAACCTATAGATCAAGTTTGG + Intergenic
1086008657 11:82071177-82071199 CCCAAAATAATGATGAAGTTTGG - Intergenic
1086048815 11:82565021-82565043 CTATAAATAGAGCTGAAGTTTGG - Intergenic
1086194597 11:84122157-84122179 CTGAAAATACAAATTTAGTTGGG + Intronic
1087126626 11:94633779-94633801 TTGAAATTATAGATGCATTTGGG - Intergenic
1087706737 11:101501926-101501948 CTGAAAACATAAATGTATTTAGG - Intronic
1088032726 11:105271008-105271030 CAGAAAAATTAGATGACGTTGGG - Intergenic
1089988635 11:122837124-122837146 CTGATAAATTTGATGAAGTTTGG - Intergenic
1090319795 11:125832362-125832384 CTGAAAATGTTGAAGAAGCTTGG - Intergenic
1090357742 11:126151246-126151268 CAGAACAGAAAGATGAAGTTTGG - Intergenic
1090434231 11:126673558-126673580 GTGAAAACACAGATGAATTTTGG - Intronic
1090841476 11:130492062-130492084 CTGGATCTATAGATCAAGTTAGG + Intergenic
1091454318 12:594753-594775 TTGAATCTATAGATCAAGTTAGG - Intronic
1092260948 12:6953083-6953105 CCAAAAATATTGATGCAGTTTGG - Intronic
1093340764 12:17970724-17970746 TTGAACATATACATCAAGTTTGG + Intergenic
1093488198 12:19675793-19675815 CTGAATTTATAGATCAATTTGGG + Intronic
1093759088 12:22886124-22886146 TTGAATCTATAGATCAAGTTGGG + Intergenic
1094007165 12:25767209-25767231 CACACAATATAGATGAAGCTCGG - Intergenic
1094124519 12:27009320-27009342 CTGAATATATACATTAATTTAGG + Intronic
1095833708 12:46614622-46614644 TTGAATCTATAGATGAATTTAGG - Intergenic
1095877332 12:47095712-47095734 CTGAAAAAATATTTGAAATTAGG - Intronic
1096379483 12:51143966-51143988 TTGAACCTATAGATGAATTTGGG - Intronic
1096932709 12:55231930-55231952 TTGAATCTATAGATAAAGTTGGG - Intergenic
1097256278 12:57677577-57677599 GAGAAAATCTAGATGAACTTGGG + Intergenic
1097778682 12:63678012-63678034 TTGAATATATAGATCAAGTTGGG + Intergenic
1098056267 12:66509030-66509052 CTGAGAATATATATTAAGTTAGG - Intronic
1098060061 12:66552541-66552563 CGTAAAATAGACATGAAGTTCGG - Intronic
1098242831 12:68485933-68485955 CTGGATATATAGATCAATTTAGG - Intergenic
1098982165 12:76968328-76968350 CTGAATATATAAATGAATGTAGG + Intergenic
1099459419 12:82904224-82904246 CTGAGATTACAGATGGAGTTAGG + Intronic
1099596938 12:84678857-84678879 CAGAAAATATAAATGTACTTTGG - Intergenic
1099742091 12:86651471-86651493 CTCAAAATATTAATGGAGTTAGG - Intronic
1099950775 12:89300610-89300632 CTGACTATATAGATTAATTTGGG - Intergenic
1100843224 12:98633928-98633950 CTGAAAATATGGTTGATCTTTGG - Intronic
1101142211 12:101808187-101808209 TTGAATCTGTAGATGAAGTTGGG - Intronic
1101179581 12:102200252-102200274 TACACAATATAGATGAAGTTAGG - Intergenic
1101279157 12:103233390-103233412 CTGAATCTATAGATCAAGTTGGG + Intergenic
1101936190 12:109059495-109059517 ATAAAAATAAAAATGAAGTTGGG - Intronic
1102203168 12:111072181-111072203 CTGAGTCTATAGATCAAGTTGGG + Intronic
1103430572 12:120881746-120881768 CGCTAAATATAGATGAAGCTCGG + Intronic
1104427791 12:128692495-128692517 CTGAAAATAGAAACCAAGTTGGG - Intronic
1104711005 12:130986216-130986238 TTGAATATATAGATCAATTTGGG + Intronic
1105285177 13:18997590-18997612 CTGAAAATAGAGATGAACATAGG - Intergenic
1106150143 13:27092291-27092313 CTGAACCTATAGATGAAGTTGGG - Intronic
1106771644 13:32966834-32966856 TTGAATCTATAGATCAAGTTGGG + Intergenic
1106920068 13:34553689-34553711 TGGAAAATATAGAATAAGTTTGG + Intergenic
1107236827 13:38180660-38180682 CCGCACATCTAGATGAAGTTAGG + Intergenic
1107575297 13:41712647-41712669 CTAAACATAAAGATGATGTTTGG + Intronic
1107660178 13:42631110-42631132 ATGAATAGAGAGATGAAGTTTGG + Intergenic
1107728290 13:43322066-43322088 CTAAAAATATGGATAAAATTTGG - Intronic
1107843739 13:44488859-44488881 CTGAATCTACAGATGAATTTGGG - Intronic
1107847333 13:44529996-44530018 CTGAATCTAAAGATCAAGTTGGG - Intronic
1108399469 13:50024599-50024621 ATGAAAATATAGATGTATATGGG + Intergenic
1109066647 13:57702567-57702589 CTGCAAATATAAATGATGTCTGG - Intronic
1109300171 13:60583031-60583053 CTGAAACTATGGCTGAAGATAGG - Intergenic
1109520486 13:63503888-63503910 TTGAAAATCCAGATGAATTTAGG + Intergenic
1110301441 13:73933615-73933637 ATGAAAACTTAGATGAATTTTGG - Intronic
1110446463 13:75588228-75588250 CTGAAAGAATATATAAAGTTGGG - Intronic
1110577657 13:77078486-77078508 CTCAAAGTATAGGTGAAGTAAGG + Intronic
1110827015 13:79983202-79983224 CAGAATCTATAGATCAAGTTGGG + Intergenic
1110976735 13:81846590-81846612 CTAAAACTATAAAAGAAGTTTGG + Intergenic
1111000077 13:82166261-82166283 CTGAAAATAAGGAAGAAATTGGG + Intergenic
1111166354 13:84462646-84462668 CAGAAAATAAGGAGGAAGTTTGG - Intergenic
1111282663 13:86047470-86047492 CTGAAACTATAGGTTAACTTTGG + Intergenic
1111302595 13:86365221-86365243 CTTAATAAAAAGATGAAGTTTGG + Intergenic
1111711868 13:91826471-91826493 CTGAAAATATACATTAATTTAGG - Intronic
1112363423 13:98737776-98737798 CTGAAAATGTAGAAGAGCTTTGG + Intronic
1112681340 13:101768880-101768902 GAGAAAATCTAGATGAACTTAGG + Intronic
1112683558 13:101795918-101795940 CTGAAAATACAGCTGAATTGAGG + Intronic
1112959817 13:105109954-105109976 CAGAAAACATAGATGACATTGGG - Intergenic
1112976399 13:105324077-105324099 CAGAAATGATAGATGAAGTTGGG - Intergenic
1114237238 14:20833981-20834003 CTGAAAATTTAGGTAAAGTAGGG + Intergenic
1114564241 14:23617140-23617162 CTGAAAAAAAAAATGAAATTAGG - Intergenic
1114695999 14:24628288-24628310 CTGAAAATATCACAGAAGTTAGG - Intergenic
1114908730 14:27164627-27164649 TTGAATGTATAGATTAAGTTGGG + Intergenic
1115169424 14:30487343-30487365 TTGAATCTATAGATCAAGTTGGG - Intergenic
1115193174 14:30768891-30768913 CTGAACAAACAGATGAACTTTGG + Intergenic
1115639877 14:35327832-35327854 TTGAATCTATAGATCAAGTTGGG - Intergenic
1115719170 14:36141301-36141323 TTGAATCTATAGATCAAGTTGGG + Intergenic
1116721428 14:48501238-48501260 TTGAAATAATATATGAAGTTAGG + Intergenic
1117630951 14:57690884-57690906 CTCTAAATACAGATGAAGCTTGG + Intronic
1117774761 14:59172047-59172069 CTGAAAATACAGATATATTTTGG + Intergenic
1118667651 14:68087277-68087299 CTGAACCTATGGATTAAGTTTGG + Intronic
1118794273 14:69126488-69126510 TTGAATCCATAGATGAAGTTGGG - Intronic
1118840910 14:69510262-69510284 TTGAATCTATAGATCAAGTTGGG + Intronic
1119026954 14:71160815-71160837 TTGAAAATATAGATGGCTTTTGG - Intergenic
1119046008 14:71319948-71319970 CTGAATATATAGTAGAAATTTGG + Intergenic
1120336242 14:83159109-83159131 CTGAATCTATAGATTAATTTGGG - Intergenic
1120538497 14:85726626-85726648 CTAAAAATATTGAGTAAGTTGGG + Intergenic
1121430872 14:93887397-93887419 TTGAATCTATAGATCAAGTTGGG + Intergenic
1122190789 14:100041684-100041706 CTGAAAATATCTTTGAAGTCTGG - Intronic
1122381728 14:101312055-101312077 CTGAATCTATAGATCAAATTGGG - Intergenic
1123860274 15:24458877-24458899 CTGAAAGTATACATAAAGTGGGG - Intergenic
1123951358 15:25280085-25280107 GGGGAAATATTGATGAAGTTGGG + Intergenic
1124078141 15:26465729-26465751 CTGACCTTATAGAAGAAGTTAGG - Intergenic
1124121995 15:26895515-26895537 TTGAAAATATAAATGAGGCTGGG + Intronic
1124207024 15:27729858-27729880 CTTAAAAAATAGATGACATTGGG + Intergenic
1124245147 15:28063076-28063098 CTGAAAATGTAGATTAATTTGGG + Intronic
1124428666 15:29586811-29586833 CTGACAATATAGATGTAATTTGG + Intergenic
1124710899 15:32009658-32009680 CTGAAAATAAAGCACAAGTTTGG - Intergenic
1124968044 15:34453922-34453944 CTGAATTTATAAATGAATTTTGG + Intergenic
1124986909 15:34627636-34627658 CTGAAAACATACATTAATTTAGG - Intergenic
1125135183 15:36333047-36333069 CTGTAAATATAGATGAAACTTGG - Intergenic
1125166184 15:36707647-36707669 CTGAAAAGGTTGATGAAGCTAGG + Intronic
1125442850 15:39722048-39722070 CTGCAAATACAGTTGAACTTGGG - Intronic
1126337235 15:47599461-47599483 CTCAAAAAGTAGATGGAGTTTGG + Intronic
1126383698 15:48073121-48073143 CTGAAATTCAAGATGAGGTTTGG + Intergenic
1126771888 15:52065783-52065805 CTGACATTATAGATGCAGCTAGG - Exonic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1128389625 15:67174284-67174306 CTGGAAACACCGATGAAGTTTGG + Intronic
1128703132 15:69818800-69818822 GTGAAATTTTAAATGAAGTTTGG + Intergenic
1129946129 15:79540702-79540724 CTGAAACAATAGAGGAAGTGGGG + Intergenic
1132033411 15:98458013-98458035 TTTAAAACATTGATGAAGTTAGG - Intronic
1132385709 15:101398492-101398514 CTGTAAATGTCGATGTAGTTGGG + Exonic
1133007505 16:2892548-2892570 ATGAAAATATAAATGCAGTCGGG + Intronic
1133214236 16:4281651-4281673 CTGTAGATACAGATGAAGCTTGG + Intergenic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1134815374 16:17201299-17201321 CTGAAATTGATGATGAAGTTAGG - Intronic
1135273732 16:21092038-21092060 TTGAATCTATAGATCAAGTTGGG - Intronic
1137436634 16:48459875-48459897 TTGAATCTATAGATCAAGTTAGG + Intergenic
1137823721 16:51470177-51470199 CTCAAAAAATAAATGATGTTAGG + Intergenic
1139221131 16:65183362-65183384 CTAAAAATATAGCTGCTGTTTGG + Intergenic
1140771579 16:78210102-78210124 ATGACAAAATAGATGAAGCTCGG - Intronic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1143308111 17:5964809-5964831 TTGAATCTATAGATCAAGTTAGG + Intronic
1143383869 17:6514262-6514284 CTTAAAATTTTGTTGAAGTTTGG - Intronic
1144048463 17:11474914-11474936 TTGAATCTATAGATCAAGTTGGG + Intronic
1144546762 17:16203874-16203896 CTGAAATTGTAGGTGAAGTTTGG - Intronic
1145299609 17:21623435-21623457 CTGAAATTGTAGGTGAAGTTTGG + Intergenic
1145350672 17:22079832-22079854 CTGAAATTGTAGGTGAAGTTTGG - Intergenic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1146554105 17:33808593-33808615 CTGAATCTATGGATCAAGTTGGG + Intronic
1147346542 17:39800603-39800625 CTGAAAACATAGACAAAGATGGG - Intronic
1148291943 17:46459892-46459914 GTGAAAATATAGATAAAGTCTGG + Intergenic
1148314133 17:46677583-46677605 GTGAAAATATAGATAAAGTCTGG + Intronic
1149167489 17:53770180-53770202 CTGAGAATATACATTAAGTAAGG + Intergenic
1149236575 17:54597718-54597740 TTGAATATATAGATTAGGTTTGG - Intergenic
1149835905 17:59912031-59912053 TTGAAAATATCTATGAAATTAGG - Intronic
1149853613 17:60058180-60058202 CTGAATCTATAGATCAAGTTGGG + Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1150480987 17:65510453-65510475 CTGAATCTATAGATCAATTTGGG - Intergenic
1151032680 17:70759246-70759268 CTAAAAATGTAGATGTAGCTTGG - Intergenic
1151112877 17:71700291-71700313 CTGAAAATTTAGATGGACCTGGG - Intergenic
1152601881 17:81266831-81266853 TTGAAACTATAGATTAACTTGGG - Intronic
1153751358 18:8234179-8234201 CTGAATCTATAGATCAATTTGGG + Intronic
1154282884 18:13022752-13022774 TTGAATGTATAGGTGAAGTTGGG + Intronic
1154290912 18:13105934-13105956 CTGAATATGTAGATCAATTTAGG - Intronic
1154951320 18:21212893-21212915 ATGAATCTATAGATCAAGTTGGG + Intergenic
1154981619 18:21506897-21506919 ATAAAAATAAAGATGAATTTGGG - Intronic
1155076966 18:22366778-22366800 CTTAAAATATTGATGAAATGTGG + Intergenic
1155105087 18:22656011-22656033 CTGAAAATAGAGATTAAGTAAGG - Intergenic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1155786445 18:29908285-29908307 CTGAAAATATGGATTTAGGTTGG - Intergenic
1156258244 18:35420104-35420126 TTGAATATATAGATTAATTTAGG + Intergenic
1156285164 18:35686275-35686297 CTGAATTTATATATGAATTTGGG - Intronic
1156417637 18:36914073-36914095 CTGAAAATATACAAGAAGGAAGG + Intronic
1156581435 18:38381174-38381196 ATCAAAATATAGAGAAAGTTTGG + Intergenic
1156718458 18:40040925-40040947 TAGAAATTAAAGATGAAGTTTGG - Intergenic
1156759881 18:40575650-40575672 CTGAAAATATAGTTGAAAGGTGG + Intergenic
1156813844 18:41284781-41284803 TTGAATCTATAGATTAAGTTGGG - Intergenic
1157213882 18:45765946-45765968 CTGAAGATATAGACAAAGGTTGG - Intergenic
1158578751 18:58662863-58662885 CCAAAAATATAGAAGAAGCTGGG + Intergenic
1158701036 18:59747007-59747029 TTGAATCTATAGATGAAGATAGG + Intergenic
1159433527 18:68385778-68385800 CAGAAAATATAAGTGAAGTAAGG + Intergenic
1159554758 18:69933444-69933466 CTGGAAATATAGGTGTAATTTGG - Intronic
1159788649 18:72747870-72747892 CTGACAATAAAAATAAAGTTGGG + Exonic
1159939758 18:74397879-74397901 CAGAAAATATGGATGGTGTTGGG - Intergenic
1161184791 19:2910038-2910060 TTGAATCTATAGATCAAGTTGGG + Intronic
1163219644 19:15907705-15907727 CTGAATCTATAGATTTAGTTGGG - Intergenic
1163226852 19:15968490-15968512 TTGAATCTATAGATCAAGTTGGG - Intergenic
1164149177 19:22533527-22533549 GTGAAATTATAGTTGAAGTGAGG - Intergenic
1164568151 19:29345807-29345829 CTGAAATTATAAATGAAAGTAGG + Intergenic
1164644790 19:29850580-29850602 CTGAAGCTATAGATCAATTTGGG - Intergenic
1164815529 19:31198851-31198873 CTGAGTCTATAGATCAAGTTGGG - Intergenic
1164893784 19:31850296-31850318 TTGAATCTATAGATCAAGTTGGG - Intergenic
1166451072 19:42901186-42901208 CTTAAAAAATAAATGAAGTGTGG + Intronic
1166582176 19:43910908-43910930 ATGAATATATAGATGAGTTTGGG - Intergenic
1166922997 19:46244243-46244265 TTGAATATATAGATCAATTTGGG - Intergenic
1167804969 19:51775003-51775025 GAGAAAATCTAGATGACGTTTGG - Intronic
925392547 2:3506619-3506641 CTGAACCTATAGATTAAGTTTGG - Intronic
925565364 2:5247968-5247990 CTGAATCTATAGATCAAGTTGGG - Intergenic
925701258 2:6640645-6640667 CTGAAAATATAGATGAACTCAGG - Intergenic
926300523 2:11598949-11598971 CTGAAAAGATGGATGATGTTTGG + Intronic
927002173 2:18808953-18808975 CTGAAACTATAGATGAACTTAGG - Intergenic
927607399 2:24499359-24499381 TTAAATATATAGATGAATTTTGG + Intronic
928191257 2:29171165-29171187 TTGACTATATAGATCAAGTTGGG + Intronic
929060177 2:37915430-37915452 CTGAAAATCTAGTTGGAGATGGG - Intergenic
929767820 2:44864038-44864060 CTGAATCTATAGATCAAATTGGG - Intergenic
929900367 2:45995932-45995954 TTGAATATATAGATCGAGTTTGG + Intronic
930331176 2:49986766-49986788 TTGAAAATATACATTAGGTTGGG + Intronic
930636184 2:53808241-53808263 CTGAAAAAAGAAATTAAGTTTGG + Intronic
930813578 2:55568892-55568914 CTGAAAATACAGCTAAAGTGTGG + Intronic
930846612 2:55912751-55912773 TTGAAAATATAGCTGAAAGTTGG + Intronic
930982249 2:57541177-57541199 TTGAAATTATAGATAAATTTAGG + Intergenic
931324471 2:61204602-61204624 CTGAAAATAAAAACAAAGTTTGG + Intronic
931339452 2:61385281-61385303 CTGAATCTATAGATGAATTTCGG - Intronic
931580619 2:63768455-63768477 TTGAATTTATAGATGAAATTGGG + Intronic
931993414 2:67814489-67814511 TTGAATATATAGATCAATTTAGG - Intergenic
932470840 2:71955149-71955171 TTGAATATATAGATCAAGTTGGG + Intergenic
932968807 2:76513295-76513317 GAGAAAATATAGATGATCTTGGG - Intergenic
932983251 2:76696409-76696431 AAGAAAATCTAGATGAACTTGGG - Intergenic
933838817 2:86268554-86268576 TTGAATCTATAGATCAAGTTGGG - Intronic
934488582 2:94739804-94739826 CAGAAAATGTAGATAAATTTAGG - Intergenic
935269904 2:101425212-101425234 TGGAAAATATGGATGTAGTTGGG - Intronic
935396256 2:102612394-102612416 CTGAATATATATTTGAAGGTAGG - Intergenic
936530634 2:113274690-113274712 CTGTAATTATTGATGGAGTTGGG - Intronic
936781027 2:116032759-116032781 CTGAATCTATAGATCAATTTTGG + Intergenic
937497633 2:122440198-122440220 CTGAATTTATAGATTAATTTAGG - Intergenic
937743563 2:125384837-125384859 CTGAATCTATAGATCAAATTGGG - Intergenic
938041215 2:128077811-128077833 CTGAAACAAGAGATGAAGATTGG - Intergenic
938198113 2:129350091-129350113 TTGAATGTATAGATCAAGTTGGG + Intergenic
938737008 2:134194911-134194933 CTGATAATGCAGTTGAAGTTGGG + Intronic
938834577 2:135087453-135087475 TTGAATATATAGATTAACTTGGG + Intronic
939120188 2:138107221-138107243 CAGAATATAGAGATGAGGTTTGG + Intergenic
939437865 2:142201864-142201886 CTGAGATAATAGATGAAGGTGGG + Intergenic
939802294 2:146724920-146724942 TTGAATTTATAGATCAAGTTGGG - Intergenic
939872720 2:147542909-147542931 GTGAAAATACAAATGCAGTTTGG - Intergenic
940013753 2:149082085-149082107 CTGCAAACATCGAGGAAGTTAGG - Intronic
940472908 2:154121393-154121415 TTGAATTTATAGATCAAGTTGGG + Intronic
940619312 2:156090930-156090952 TTGAAACTATAGATCAAGTTGGG + Intergenic
940714156 2:157200147-157200169 TTGAATCTATAGATCAAGTTGGG - Intergenic
940732600 2:157410654-157410676 CTGAATCTACAGATTAAGTTGGG + Intergenic
940852038 2:158697134-158697156 TTGAATCTATAGATCAAGTTGGG - Intergenic
940856465 2:158732162-158732184 CTTGAAAGATAGATGAAATTTGG - Intergenic
942012807 2:171780004-171780026 CTGAATTTATAGATCAATTTGGG - Intergenic
942405054 2:175645303-175645325 CTGAATCTATAGAGCAAGTTGGG + Intergenic
943918636 2:193673431-193673453 TTGAATTTATAGATGAATTTGGG - Intergenic
943936945 2:193931433-193931455 ATGAAAATATAGATGAATAAGGG + Intergenic
944361086 2:198857581-198857603 CTGTAAATGTAGATGAAATTAGG + Intergenic
944700753 2:202243881-202243903 CTGAATCTATATATCAAGTTGGG + Intergenic
945511745 2:210711822-210711844 TTGACAATATAAATGAAGTATGG - Intergenic
945674226 2:212835727-212835749 TTGAATCTATAGATGAAGTTAGG + Intergenic
945794321 2:214342883-214342905 CTGAACATATTAATAAAGTTGGG + Intronic
946537174 2:220643986-220644008 CTCAAAATATATATGATTTTGGG - Intergenic
946807704 2:223487835-223487857 CTAAAAATGTAGATGAGTTTTGG - Intergenic
947030696 2:225790193-225790215 TTGAATCTATAGATCAAGTTAGG + Intergenic
947466638 2:230355475-230355497 TTGAAACTATAGATAAATTTGGG - Intronic
948649538 2:239432017-239432039 CTGAATTTATAGATTAATTTAGG + Intergenic
948724531 2:239925112-239925134 CTAAGACTATAGATGAATTTAGG - Intronic
1170161491 20:13317365-13317387 TTGAATCTATAGATCAAGTTGGG - Intergenic
1170378152 20:15725159-15725181 TTGAATCTATAGATCAAGTTGGG + Intronic
1170481745 20:16772700-16772722 TTGAAAATATAGATAAGCTTGGG + Intergenic
1170754664 20:19189293-19189315 ATTGAAATATAGATGAAGTTGGG + Intergenic
1171069367 20:22052010-22052032 GAGAAAATATAGCTGAACTTGGG - Intergenic
1171432921 20:25096608-25096630 TTGAATCTATAGATTAAGTTAGG - Intergenic
1171560922 20:26124818-26124840 CTGAAATTGTAGGTGAAGTTTGG - Intergenic
1172877654 20:38175609-38175631 CTGAAAATATTGGTGAAGAGAGG - Intergenic
1173084868 20:39906151-39906173 CTCAGAATTTAGATGAGGTTAGG + Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175217168 20:57397478-57397500 CTGAAACTATACATGCAGTGGGG - Intronic
1175499015 20:59436291-59436313 CTAGAAAAATAGAAGAAGTTGGG + Intergenic
1176650295 21:9540251-9540273 CTGAAATTGGAGGTGAAGTTTGG + Intergenic
1177023240 21:15889157-15889179 CTGGATTTATAGATGAATTTGGG - Intergenic
1177027821 21:15942693-15942715 CTGGAAATGTAGATTCAGTTTGG + Intergenic
1177098776 21:16873247-16873269 TTGAAATTATAGAGTAAGTTGGG + Intergenic
1177257589 21:18686231-18686253 TTGAACATATAGATCAATTTGGG - Intergenic
1177560986 21:22753509-22753531 CTGAAATTAAAGATGATGTTTGG - Intergenic
1177709597 21:24755444-24755466 TTTAAAATATAGATGAAATAAGG - Intergenic
1178031500 21:28531867-28531889 TTGAATCTATAGATCAAGTTGGG + Intergenic
1178105356 21:29312831-29312853 ATGAAAATATAGATCTATTTGGG - Intronic
1178249197 21:30985832-30985854 CTGAAAAGAAAAATGAAATTCGG - Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1178547408 21:33503983-33504005 TTAAAAAAATAGATGAAGTAAGG + Exonic
1180572390 22:16738936-16738958 CTGAAAATATATACAAATTTGGG + Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1182230915 22:28836950-28836972 AAGAAAATAAAGATGGAGTTGGG - Intergenic
1183095099 22:35547234-35547256 CTGGAAATAGTGATGAAGTCGGG + Intronic
1183131863 22:35844804-35844826 CTGAAAATAAAACTGAAGTAAGG - Intronic
949389875 3:3548423-3548445 TTGAATCTATAGATCAAGTTAGG + Intergenic
949455827 3:4237713-4237735 CTGAAAATTTAGATGATCTTGGG - Intronic
950352148 3:12365969-12365991 TTGAATCTATAGATCAAGTTGGG + Intronic
950513507 3:13448106-13448128 CTGAAACTATAGGTGAATTTGGG - Intergenic
950994137 3:17476662-17476684 CTGAATCTATAGATCAATTTGGG + Intronic
951331283 3:21371626-21371648 CTGAATATATTGATCAAGTTGGG + Intergenic
951533070 3:23716351-23716373 CTGAATCTATAGATCAAGCTGGG + Intergenic
952557056 3:34544100-34544122 ATGAAGATAGAGATGAAGATTGG - Intergenic
952703930 3:36357450-36357472 TTGAATCTATAGATCAAGTTGGG + Intergenic
953422733 3:42767508-42767530 TTGAATCTATAGATCAAGTTGGG - Intronic
953600102 3:44354478-44354500 TTGAATCTATAGATCAAGTTGGG + Intronic
955169990 3:56554272-56554294 TTGAATCTATAGATCAAGTTGGG + Intergenic
955705239 3:61720622-61720644 CTGATATCATAGATGAGGTTTGG + Intronic
956339017 3:68199427-68199449 TTGAAATTATAGATCAAGCTGGG + Intronic
957120885 3:76090521-76090543 TTGAAACTATAGATCAACTTTGG - Intronic
957330928 3:78762412-78762434 CTGGAAATATAAATGAAATTAGG - Intronic
957400440 3:79705744-79705766 CTGAATCTATAGAACAAGTTGGG + Intronic
957863167 3:85985654-85985676 CTTTAAATGTAGATGAATTTAGG + Intronic
958001732 3:87759324-87759346 TTGAATCTATAGATCAAGTTGGG - Intergenic
958263131 3:91405693-91405715 GTGAAAATAAAGATAGAGTTTGG + Intergenic
959198788 3:103220428-103220450 CTGCAAAAACTGATGAAGTTCGG + Intergenic
959499935 3:107094949-107094971 TTGAATCTATAGATCAAGTTGGG - Intergenic
959689359 3:109181964-109181986 CTGGAAATAGAGACGTAGTTTGG + Intergenic
959833107 3:110888648-110888670 ATGTAAATATAGATATAGTTTGG + Intronic
960020370 3:112945146-112945168 TTGAATACATAGATCAAGTTGGG - Intronic
960267069 3:115632290-115632312 CTGAAAATGTAGATACAGTTTGG + Intronic
960547321 3:118930806-118930828 CTGAATCTATAGATCAATTTAGG - Intronic
960559258 3:119064603-119064625 CTGAAACTATAGATTAATTTGGG + Intronic
960849775 3:122040822-122040844 AAGAAAATATAGATGACCTTGGG + Intergenic
960889250 3:122429629-122429651 TTGAATCTATAGATCAAGTTGGG - Intronic
961732477 3:128976405-128976427 TTGAATATATAGATTAATTTGGG - Intronic
961908662 3:130290386-130290408 CTGAAACTATAGGTTAATTTGGG + Intergenic
962824063 3:139082897-139082919 TTGAAACTATAGATCAGGTTGGG + Intronic
962939439 3:140112300-140112322 CTGAAATTGTAGATGAAATGAGG + Intronic
963338525 3:144004916-144004938 TTGAAAATTTAGATGAATCTTGG + Intronic
963385644 3:144589628-144589650 TTGAAATTATAGATAAATTTGGG + Intergenic
964591116 3:158362755-158362777 CAGAAAATCTAGATAATGTTTGG - Intronic
965224503 3:165971480-165971502 CTGAAAATGTGGAAGAAATTTGG + Intergenic
965326527 3:167310917-167310939 ATGAATCTATAGATCAAGTTGGG - Intronic
965440452 3:168706648-168706670 CTCAAAATACAGAGGAAGTTTGG + Intergenic
966094826 3:176187436-176187458 CTGAAGAAATAAATGAACTTTGG + Intergenic
966638273 3:182159738-182159760 AAGAAAATATATAAGAAGTTTGG - Intergenic
966895940 3:184445165-184445187 CTGAAAATATCCATGAACTCTGG + Intronic
967085049 3:186087107-186087129 CTGAACCTATAGATAAATTTGGG - Intronic
970043159 4:11819787-11819809 GTGAGAATAAAGATGAAGCTTGG + Intergenic
970049049 4:11891607-11891629 CTGATTATATAGGTCAAGTTGGG - Intergenic
970463090 4:16295573-16295595 CTCAAAATATAGAGGGAGGTGGG + Intergenic
970949813 4:21741534-21741556 CTTAAAGTATAGATGATGCTGGG - Intronic
971837391 4:31786161-31786183 CTGTAAATACAGATAAAGCTTGG - Intergenic
972165428 4:36277856-36277878 CTGAAAGTAAAGATGAACTTAGG - Intergenic
972810898 4:42584781-42584803 TTGAATATATATCTGAAGTTTGG - Intronic
972939119 4:44175889-44175911 GTGAAAATATAGTTGAAATATGG + Intronic
973028711 4:45308403-45308425 CTGAATATATAAATCAAGTTGGG + Intergenic
973764090 4:54148193-54148215 CAGAAAATATAATCGAAGTTGGG + Intronic
973841572 4:54866488-54866510 TTTAAAAAGTAGATGAAGTTGGG - Intergenic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974170238 4:58257524-58257546 TTGAATTTATAGATCAAGTTGGG - Intergenic
974752196 4:66155540-66155562 CTCCAAATATATATGAAGTATGG + Intergenic
974940874 4:68466138-68466160 CTGAAAAGGAAGATGAGGTTAGG - Intronic
975958394 4:79870276-79870298 TTGAAGCTATAGATCAAGTTGGG - Intergenic
976060301 4:81119946-81119968 TTGAATTTATAGATCAAGTTGGG + Intronic
976838136 4:89399429-89399451 CTGAAAAAATAGAAGTGGTTGGG + Intergenic
977280907 4:95038590-95038612 CCAAAAATATTTATGAAGTTAGG - Intronic
977454478 4:97240730-97240752 TTGAATCTATAGATCAAGTTGGG - Intronic
977482965 4:97601855-97601877 CTAAATTTATAGATCAAGTTGGG + Intronic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
978129397 4:105176690-105176712 CTGAATCTATAGATCAAGTTGGG - Intronic
978441080 4:108734084-108734106 TTATAAATATAGATGTAGTTAGG + Intergenic
978948881 4:114532747-114532769 TTGAATATATAGATCAATTTGGG - Intergenic
979045976 4:115865018-115865040 CCTAATATATAGATCAAGTTAGG - Intergenic
979279246 4:118846706-118846728 CGGAAAATGTGGATAAAGTTTGG - Intergenic
979301378 4:119091521-119091543 CTGAAAAGATATTTGAAATTGGG - Intergenic
979903360 4:126252265-126252287 TTGAACCTATAGATCAAGTTGGG - Intergenic
979987219 4:127330099-127330121 CTGGAAATAGATATCAAGTTTGG - Intergenic
980696866 4:136368362-136368384 CTTAGAAAATAGATGAATTTTGG - Intergenic
981167167 4:141574423-141574445 CTAAAAGTATAAATGATGTTGGG - Intergenic
981182651 4:141763963-141763985 CTGTAAATACACATGAAGCTGGG + Intergenic
981185488 4:141797272-141797294 GAGAAAATATAGATGACCTTGGG - Intergenic
981224381 4:142275885-142275907 CAGAAAATCAAGATCAAGTTGGG - Intronic
981273720 4:142874229-142874251 CTGAAGCTATAGATTAATTTTGG - Intergenic
981306383 4:143250880-143250902 GTGGAAATAGACATGAAGTTGGG + Intergenic
981711316 4:147711301-147711323 CTGAAAATACAAAAGTAGTTGGG - Intergenic
981874973 4:149531037-149531059 TTGAATATATACATGAAGTATGG - Intergenic
981907284 4:149936080-149936102 TTGACAACATAGATGAATTTGGG - Intergenic
981980094 4:150781474-150781496 CTATAAATACAGATGAAGCTTGG + Intronic
982161176 4:152571060-152571082 CAGAATCTATAGATCAAGTTGGG + Intergenic
982350985 4:154415361-154415383 CTGAAAATTTGGAGCAAGTTAGG - Intronic
982491412 4:156034370-156034392 TTGAATCTATAGATCAAGTTGGG + Intergenic
982697433 4:158619005-158619027 TTGAAAATATAGAAGACGATGGG + Intronic
982752645 4:159180475-159180497 CTGCTATTATAGATGCAGTTAGG - Intronic
982895416 4:160916100-160916122 CTGATTCTATAGATCAAGTTGGG + Intergenic
983431951 4:167661330-167661352 CAGAAAATAAAAATGAATTTTGG + Intergenic
983571614 4:169214496-169214518 TTGAATCTATAGATCAAGTTGGG + Intronic
984601577 4:181733067-181733089 CTGAAAATGCAGATGAAGGTTGG + Intergenic
986176596 5:5357751-5357773 CTGAAACTACAGATGCTGTTTGG + Intergenic
986363750 5:7008437-7008459 AGCAAAATAAAGATGAAGTTAGG + Intergenic
986998651 5:13636267-13636289 GTGATAATATAGATGAACTTTGG + Intergenic
987455911 5:18146401-18146423 ATGAAAATAATGATGAAGTAGGG + Intergenic
987743543 5:21941059-21941081 CTGAAAATCTAAATGTAATTTGG + Intronic
987896032 5:23948390-23948412 CTTAAAATATAGGTCAAGATAGG - Intergenic
988007438 5:25435066-25435088 TTGAATCTATAGATCAAGTTGGG - Intergenic
988043288 5:25914928-25914950 ATTAAAATTTAGAGGAAGTTTGG - Intergenic
988186991 5:27877844-27877866 ATGAATCTATAGATCAAGTTGGG + Intergenic
989022348 5:37023462-37023484 CAGAAAGTACAGATGAAGTATGG - Intronic
989153354 5:38321345-38321367 CTGTAAATACAGACGAAGCTTGG + Intronic
989288689 5:39735423-39735445 TTGAATCTATAGATTAAGTTGGG + Intergenic
989325047 5:40182743-40182765 TTGAAAATATTGATAAATTTGGG - Intergenic
990096978 5:52128087-52128109 TTGAATCTATAGATCAAGTTGGG - Intergenic
990670602 5:58125202-58125224 CTTAAAATAGAAATTAAGTTGGG + Intergenic
991346168 5:65671129-65671151 CTTAAAATATATATCAATTTAGG - Intronic
991763739 5:69951194-69951216 CTGAAAATCTAAATGTAATTTGG + Intergenic
991783586 5:70166940-70166962 CTGAAAATCTAAATGTAATTTGG - Intergenic
991842970 5:70826262-70826284 CTGAAAATCTAAATGTAATTTGG + Intergenic
991876031 5:71167275-71167297 CTGAAAATCTAAATGTAATTTGG - Intergenic
992133166 5:73715501-73715523 CTAAAAATAGAAAGGAAGTTTGG + Intronic
992264001 5:74999620-74999642 TTGAACATACAGATTAAGTTGGG + Intergenic
992276644 5:75127697-75127719 CTGAATCTATAGATCAATTTGGG + Intronic
992316164 5:75557396-75557418 TTGAGTGTATAGATGAAGTTGGG + Intronic
992321073 5:75613480-75613502 CTGCATATATAAATGAAGGTAGG + Intronic
992575363 5:78104458-78104480 CTTAAAATATAAATGAAATCAGG + Intronic
992575643 5:78108169-78108191 GTAAAAATATAGATTTAGTTAGG + Intronic
992694269 5:79269503-79269525 TTGAATTTATAGATCAAGTTAGG + Intronic
993127074 5:83848822-83848844 CTGAAATTAGAGATGAGATTTGG - Intergenic
993935842 5:94001213-94001235 ATGAACCTATAGATTAAGTTGGG + Intronic
994133067 5:96253231-96253253 CTGAAAATATGGATATAGTCAGG + Intergenic
994572564 5:101532952-101532974 ATGAAAAAATTGATGAAATTAGG + Intergenic
994611970 5:102054270-102054292 TTGAAAATATAGATCAGATTGGG - Intergenic
994617498 5:102123770-102123792 TTGAATCTATAGATCAAGTTGGG + Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
994861091 5:105195156-105195178 TTGAAAATATATATGAAATTGGG - Intergenic
994947352 5:106412994-106413016 CAGAAAATATAGAAGACTTTAGG + Intergenic
995891451 5:116957188-116957210 ATGAATATATAGATTAATTTAGG - Intergenic
996040276 5:118801427-118801449 GGGAAAATATAGATGGATTTGGG - Intergenic
996318626 5:122189488-122189510 TTGATAATATAGATGAACTCTGG - Intergenic
996778931 5:127161914-127161936 TTGAATCTATAGATCAAGTTGGG + Intergenic
996826964 5:127694455-127694477 CTTTAATTATATATGAAGTTTGG - Intergenic
996883518 5:128328019-128328041 ATGAAAATATAAATGAAGAAAGG - Intronic
997163346 5:131632725-131632747 CTGAAAACAGAAATGAACTTGGG + Intronic
998399371 5:141840454-141840476 ATAAAAATAGAGATGGAGTTGGG + Intergenic
1000238745 5:159389015-159389037 CTGAATCTATAGATCAAGTTGGG + Intergenic
1000405225 5:160880370-160880392 TTGAACCTATAGATCAAGTTTGG - Intergenic
1000913824 5:167055474-167055496 TTGAATCTATAGATCAAGTTGGG + Intergenic
1001223811 5:169926734-169926756 CTGTAACTAGAGGTGAAGTTTGG + Intronic
1001347891 5:170923558-170923580 TTGAAACTATAGATTAACTTGGG + Intronic
1002291975 5:178206168-178206190 ATGAAAATACAGATTAAGCTGGG + Intronic
1002892211 6:1344914-1344936 TTGAACCTATAGATCAAGTTTGG - Intergenic
1003301596 6:4888897-4888919 CTGAAAATAACAAAGAAGTTGGG - Intronic
1004033418 6:11896287-11896309 TTGAATCTATAGATCAAGTTGGG + Intergenic
1004678492 6:17868465-17868487 CTGCATGTATATATGAAGTTCGG + Intronic
1004935168 6:20500306-20500328 GTGAAAACATAGATGAACCTTGG + Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1004969852 6:20897592-20897614 CTGAATATATAACTGAAGATTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005129148 6:22484498-22484520 CTCAATCTATAGATCAAGTTGGG - Intergenic
1005216836 6:23538856-23538878 TTGAATCTATAGATTAAGTTGGG + Intergenic
1005417157 6:25612158-25612180 CTGAAAATGTACATGAAGTCTGG + Intronic
1005565009 6:27082585-27082607 CTGAAATTACAGATTCAGTTCGG + Intergenic
1005613368 6:27548103-27548125 CAGAAAGCATAGAAGAAGTTCGG - Intergenic
1005713731 6:28526753-28526775 CAGAAAATAATCATGAAGTTAGG + Intronic
1006262843 6:32891030-32891052 TTGAAAATAAAGAGGAAGTTGGG - Intergenic
1007080053 6:39093911-39093933 TTAAAAATACAGATGAAGTCTGG + Intergenic
1008195852 6:48519433-48519455 CTGAGAATTTAGTTGAAATTGGG + Intergenic
1008873070 6:56295509-56295531 TTGAATCCATAGATGAAGTTAGG + Intronic
1008948071 6:57121441-57121463 TTGAATATATAGATCAAGTTAGG + Intronic
1008992277 6:57617195-57617217 GTGAAAATAAAGATAGAGTTTGG - Intronic
1009641547 6:66343533-66343555 CTGAAAGTTTAGCTGAACTTAGG + Intergenic
1010608768 6:77926809-77926831 CAGCAAATATTGATGTAGTTGGG - Exonic
1011442598 6:87402850-87402872 CTGAAATTATATATAAAATTAGG + Intergenic
1011456508 6:87556286-87556308 AGTAAAATATAGATGCAGTTAGG - Intronic
1012061171 6:94483609-94483631 TTGAATATATAGATAAATTTGGG + Intergenic
1012688713 6:102286838-102286860 CTGAAACTATAAATTAATTTGGG - Intergenic
1012735630 6:102938009-102938031 CTGAATCTATAGATTAAGTTGGG + Intergenic
1012803968 6:103871124-103871146 CTGAAAATATACAGGAAGTTGGG - Intergenic
1013306956 6:108857135-108857157 TTGAATCTATAGATCAAGTTGGG + Intronic
1013965806 6:115953802-115953824 TTGAATAAATAGATTAAGTTGGG - Intronic
1014211019 6:118708140-118708162 CTGCAAATATTTATTAAGTTCGG + Intronic
1014634905 6:123833493-123833515 TTGAAGCTATAGATCAAGTTGGG + Intronic
1014771341 6:125460744-125460766 GAGAAAATCTAGATGAACTTGGG - Intergenic
1015090716 6:129354372-129354394 CTGAAAATAAATGTGAAGGTAGG + Intronic
1015196773 6:130532224-130532246 TTGAAAAAATAGATGGAGTTAGG - Intergenic
1015889230 6:137952705-137952727 TTGAAGATATTGATGAAATTGGG + Intergenic
1016177085 6:141093678-141093700 TTGAATTTATAGATTAAGTTGGG + Intergenic
1016473251 6:144397716-144397738 CTTGAAAAATAGATGAAGTATGG - Intronic
1017080145 6:150660671-150660693 TTGGAATTATAGATAAAGTTTGG - Intronic
1018097571 6:160404516-160404538 TTGAATATATACATCAAGTTGGG - Intronic
1018302023 6:162413544-162413566 GTGAAAATACAGATAATGTTTGG - Intronic
1018603013 6:165565995-165566017 GAGAAAATATAGATGAACCTGGG + Intronic
1020184334 7:5947411-5947433 CTGTAAAAACAGATGAAGGTAGG + Intronic
1020298583 7:6777355-6777377 CTGTAAAAACAGATGAAGGTAGG - Intronic
1020395500 7:7712280-7712302 TTGAACATATAGATTAATTTAGG + Intronic
1020662716 7:11001461-11001483 TTGAATCTATAGATCAAGTTGGG + Intronic
1020668382 7:11074910-11074932 CTGAAAATATGGAAGCAGCTTGG - Intronic
1021066711 7:16184280-16184302 CTGAAAAAATGGATTATGTTTGG - Intronic
1021211457 7:17858561-17858583 TTGAATCTATAGATGAATTTAGG - Intronic
1022075117 7:26961099-26961121 TTGAATCTATAGATCAAGTTTGG - Intronic
1022554995 7:31284218-31284240 CTGAGAATGTAGCTGAAGTGTGG - Intergenic
1022688955 7:32626686-32626708 CTGAATCTGTAGATCAAGTTGGG - Intergenic
1022937614 7:35195678-35195700 CTGAATATATAGATCAAGTTGGG + Intergenic
1022961033 7:35426809-35426831 CTGAAAAAAATGGTGAAGTTAGG + Intergenic
1023155156 7:37243241-37243263 TTGCAAATATAGAGGAATTTGGG - Intronic
1023192469 7:37597507-37597529 TTGAAAATATATATGTAGTCAGG - Intergenic
1024221328 7:47289817-47289839 TTGAATCTATAGATGAAATTAGG - Intronic
1024501711 7:50116667-50116689 CTGAAACTATAAATCAACTTAGG - Intronic
1024923018 7:54580405-54580427 TTGAAAATATAAATGTAGTGAGG + Intergenic
1024924147 7:54595094-54595116 CTGAATTTATAGATTAATTTGGG - Intergenic
1025276912 7:57590543-57590565 CTGAAATTGTAGGTGAAGTTTGG + Intergenic
1025639924 7:63356628-63356650 CTGAATATGTAGATCTAGTTGGG + Intergenic
1025642775 7:63391464-63391486 CTGAATATGTAGATCTAGTTGGG - Intergenic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1026413249 7:70149864-70149886 TTGAGAATATTGATGCAGTTTGG + Intronic
1026599454 7:71764475-71764497 TTGACATTATAGATAAAGTTGGG + Intergenic
1027387976 7:77677297-77677319 TTGAATCTATAGATGAAGTTGGG + Intergenic
1027535264 7:79391941-79391963 CTTAAAACCTAGATGACGTTAGG - Intronic
1027854782 7:83496835-83496857 CAGAAAATATACAGGAAGATGGG + Intronic
1028261499 7:88672363-88672385 CTGATAATAGAGATGAAGGAGGG + Intergenic
1028269249 7:88767725-88767747 CTGAAAATGTAGGTGAAGGCTGG - Intronic
1028372516 7:90109918-90109940 TTGAATATATAGATCAAGTTGGG - Intergenic
1028605352 7:92649503-92649525 ATGAAAATATTCATGAAATTGGG - Intronic
1029833776 7:103288324-103288346 TTGAATATATAGATCAAGTTGGG + Intergenic
1030164636 7:106541469-106541491 ATGAAATTATAGATTAATTTGGG + Intergenic
1030289079 7:107854600-107854622 GTGAAAATATAGATGTAGCTGGG + Intergenic
1031112944 7:117633081-117633103 TTGAATCTATAGATGGAGTTGGG + Intronic
1031229646 7:119089200-119089222 CTAAAAACATAGATGAATCTGGG - Intergenic
1032416832 7:131742067-131742089 CTGAAAATCCAGATAAAGATGGG + Intergenic
1032967048 7:137109864-137109886 CTGAAAATTTAAATTTAGTTTGG + Intergenic
1034027103 7:147717400-147717422 TAGAAAATATATATGAAATTAGG - Intronic
1034306867 7:150050179-150050201 CACTAAATATAGATGCAGTTAGG + Intergenic
1034326084 7:150234667-150234689 CTGCAAAGATAGATGAATTAGGG - Intergenic
1034763698 7:153697108-153697130 CTGAAAATGTCCATGAGGTTTGG - Intergenic
1034767122 7:153734589-153734611 CTGCAAAGATAGATGAATTAGGG + Intergenic
1034799978 7:154050465-154050487 CACTAAATATAGATGCAGTTAGG - Intronic
1035148640 7:156846612-156846634 CTGAATGTATAGATGAAGTTGGG - Intronic
1035290654 7:157836732-157836754 CAGATAATATAGAAGAGGTTTGG + Intronic
1035646567 8:1226615-1226637 CTGAAAAAATAAATGAAATATGG + Intergenic
1036198079 8:6739355-6739377 TTGAAGATATAGATGAATTTGGG + Intronic
1037096169 8:14990397-14990419 CTGAAAGTACAGATGCAGCTTGG - Intronic
1038657330 8:29465761-29465783 CTGTAAATATAGATGAAGCTTGG - Intergenic
1038738866 8:30198984-30199006 CTGAAAACATGGAAGAGGTTGGG - Intergenic
1038863630 8:31414846-31414868 CTGTAAATACAGATGATGCTTGG + Intergenic
1039178519 8:34837109-34837131 TTGAATATATAGATAAACTTGGG + Intergenic
1039375404 8:37027692-37027714 TTGCAAATATTGATGAATTTGGG + Intergenic
1039624428 8:39032995-39033017 TTGAATGTATAGATCAAGTTGGG + Intronic
1039954681 8:42197836-42197858 CTCAAAATATAGATGCTTTTTGG - Intronic
1040531995 8:48273820-48273842 CTGAAAAAAAAAATGCAGTTGGG + Intergenic
1040624183 8:49126656-49126678 GTGAATCTATAGATGGAGTTGGG + Intergenic
1040690068 8:49926654-49926676 GAGAAAATATAGATGACCTTTGG + Intronic
1041093175 8:54323339-54323361 TTGAATCTATAGATTAAGTTGGG - Intergenic
1041376792 8:57214360-57214382 CTGGAAATATGCATGAAGGTGGG + Intergenic
1041658821 8:60380734-60380756 CTGAAAATATGGATAAAATCTGG + Intergenic
1041879148 8:62727766-62727788 TTGAATATATAGACTAAGTTGGG - Intronic
1041892306 8:62883127-62883149 TTGAATCTATAGATTAAGTTGGG + Intronic
1042292856 8:67187942-67187964 CAGAAAATCTAGATGACCTTGGG + Intronic
1042506953 8:69571015-69571037 CTTAAAATAACAATGAAGTTGGG + Intronic
1043234759 8:77849348-77849370 TTGAATTTATAGATCAAGTTAGG + Intergenic
1043266108 8:78269391-78269413 GAGAAAATATAGATGACTTTGGG + Intergenic
1043636084 8:82384060-82384082 CTGACAATATGGATGAACCTGGG - Intergenic
1044212100 8:89562047-89562069 ATGAAAATACACATGATGTTGGG - Intergenic
1044446597 8:92284502-92284524 CTGAAAATGTAGAGCAAGGTTGG + Intergenic
1044563366 8:93636426-93636448 CTGAAAATATTGATGATCTGAGG + Intergenic
1045352948 8:101359280-101359302 CAGAAAATTTAGAGGCAGTTGGG + Intergenic
1045400762 8:101815042-101815064 TTGAATCTATAGATCAAGTTAGG - Intronic
1045851874 8:106710017-106710039 CTGAATATATAGGTGAATTTAGG - Intronic
1046022969 8:108688534-108688556 CTCAAAATAGAAATGAAGTGGGG + Intronic
1046224741 8:111263052-111263074 TTGAAATAATAGATGATGTTAGG + Intergenic
1046434822 8:114173973-114173995 TTGAATCTATAGATGAATTTGGG - Intergenic
1046484238 8:114864712-114864734 TTGAATCTATAGATCAAGTTGGG - Intergenic
1046583357 8:116120945-116120967 CTGAGAACATTGATGAATTTTGG + Intergenic
1046634648 8:116660722-116660744 GTGTTAATATAGAGGAAGTTAGG + Intronic
1046639421 8:116710364-116710386 CTGAAAATACAGATCAAGCTGGG - Intronic
1046838851 8:118834902-118834924 TTGAAAAAATAGATAAACTTAGG + Intergenic
1046889542 8:119407152-119407174 CTTATAATATTGTTGAAGTTAGG - Intergenic
1047705508 8:127495348-127495370 TTGGAAATATAGATGAGGTAGGG + Intergenic
1048121369 8:131585064-131585086 TTGAAAATATAGATACATTTTGG + Intergenic
1048682510 8:136859760-136859782 CTGAATCTATAGATTAAGTTGGG + Intergenic
1048916764 8:139191637-139191659 ATGAAAATATGGAGGATGTTTGG - Intergenic
1049295616 8:141833846-141833868 TTGAATCTATAGATGAACTTCGG + Intergenic
1050197139 9:3097427-3097449 CTGGAAATATAATTGTAGTTAGG - Intergenic
1050667115 9:7951832-7951854 CTTAAAATACACTTGAAGTTTGG - Intergenic
1050784257 9:9379603-9379625 TTGAATCTACAGATGAAGTTGGG + Intronic
1050914961 9:11120403-11120425 TTGAATATATTGATCAAGTTGGG + Intergenic
1050924241 9:11242592-11242614 CTGAATTTATAGATAGAGTTAGG + Intergenic
1051045723 9:12871139-12871161 CTGAAAATACAGAAGTAGCTTGG + Intergenic
1051116421 9:13699079-13699101 CTGAATCTATAGATCAAGTGGGG + Intergenic
1051797910 9:20895382-20895404 TTGAATGTATAGATGAAGTTAGG + Intronic
1051805644 9:20990095-20990117 ATGAAAATAGAAATGACGTTAGG - Intronic
1052415270 9:28169973-28169995 TTAAAAATATAGATGAAATAGGG - Intronic
1052570910 9:30222310-30222332 CTGTAAATATTTATGAAGTGTGG - Intergenic
1053277224 9:36792325-36792347 CTAAAAATAAAAATGAAATTAGG + Intergenic
1053669207 9:40344559-40344581 CAGAAAATGTAGATAAATTTAGG + Intergenic
1053919008 9:42970800-42970822 CAGAAAATGTAGATAAATTTAGG + Intergenic
1054380345 9:64484582-64484604 CAGAAAATGTAGATAAATTTAGG + Intergenic
1054515405 9:66031731-66031753 CAGAAAATGTAGATAAATTTAGG - Intergenic
1055228603 9:74032030-74032052 CTTAAAATACAGAAAAAGTTGGG + Intergenic
1055480525 9:76705029-76705051 CTGAAACAATAGAGGAAGCTGGG - Exonic
1055613464 9:78046922-78046944 TTGAAAATGTAGTTGTAGTTAGG + Intergenic
1055718491 9:79145055-79145077 GAGAAAATCTAGATGATGTTGGG - Intergenic
1055767329 9:79678403-79678425 TTAAAAAAAAAGATGAAGTTAGG - Intronic
1055878355 9:80969943-80969965 CTGAAAAGATAGCTGAAAATAGG + Intergenic
1055880263 9:80992804-80992826 TTGAATATATAGATGAAGCTGGG + Intergenic
1056171739 9:83992048-83992070 TTGAATCTATAGATGAATTTGGG + Intronic
1056898428 9:90574305-90574327 GTGGGAATATAGATGAAGTAAGG + Intergenic
1057025026 9:91728285-91728307 CCTAAAATATACATAAAGTTAGG - Intronic
1057352669 9:94313648-94313670 CTAAAAACATGGATGAAGCTTGG + Intergenic
1057823738 9:98355648-98355670 CTGAATGTATAGATCAAGTTGGG - Intronic
1058232204 9:102440729-102440751 GAGAAAATATATATGAAGTTAGG - Intergenic
1058716034 9:107722716-107722738 CTGAAAATATAGCTGAATTATGG - Intergenic
1059009004 9:110436222-110436244 CTGTGGTTATAGATGAAGTTAGG - Intronic
1059991252 9:119868562-119868584 TTGAAAATATAGATCAGGGTAGG - Intergenic
1060125890 9:121044684-121044706 CTGAAAAACTAGATTAAGGTGGG - Intronic
1060446464 9:123693106-123693128 GTGTATATATAGATGAATTTTGG + Intronic
1203628035 Un_KI270750v1:43805-43827 CTGAAATTGGAGGTGAAGTTTGG + Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1186226967 X:7409697-7409719 CTGACTATATAGATTAAGTCTGG + Intergenic
1187553675 X:20331035-20331057 CTGGAAATATAGAACAAGGTAGG - Intergenic
1187647750 X:21367656-21367678 CTGAAACTGTATCTGAAGTTTGG + Intergenic
1188234491 X:27710357-27710379 TTGAATATATAGATAAATTTGGG + Intronic
1188396597 X:29692159-29692181 CTGCAACTATAGCTGATGTTTGG + Intronic
1188726353 X:33588339-33588361 CTGAATACATAGATTAAGTTTGG + Intergenic
1188891846 X:35621333-35621355 TTGAAAATATACATAAAGGTGGG - Intergenic
1189527740 X:41842740-41842762 CTGAATCTATAGATCAATTTGGG + Intronic
1189548176 X:42065563-42065585 TTGAATCTATAGATTAAGTTAGG + Intergenic
1189687391 X:43579471-43579493 CTGGAAACATAGCAGAAGTTGGG + Intergenic
1190208978 X:48429369-48429391 CTAAAAATATAAAAGTAGTTGGG - Intergenic
1190399491 X:50018041-50018063 CTGAACCTGTAGATCAAGTTGGG + Intronic
1190547119 X:51539608-51539630 TTGAATCTATAGATCAAGTTGGG + Intergenic
1190551778 X:51589871-51589893 CTGAATCTATAGATCAAGTTGGG - Intergenic
1193399274 X:81022451-81022473 TTGAATCTATAGATCAAGTTGGG - Intergenic
1193434664 X:81457955-81457977 TTGAAAATACACATGATGTTAGG - Intergenic
1194234801 X:91369623-91369645 TTGAATCTATAGATCAAGTTAGG + Intergenic
1194284275 X:91990569-91990591 CAGAAAATTTAAATGAAGTTTGG - Intronic
1194701158 X:97116043-97116065 CTGAAAATATTGCAGAACTTTGG + Intronic
1194891078 X:99380051-99380073 CTGAATACATAAATGAAGTTGGG - Intergenic
1195209887 X:102644370-102644392 CTGAATTTATAGATTAAATTTGG + Intergenic
1195279189 X:103313526-103313548 CTGAATTTACAGATGAATTTGGG - Intergenic
1195370837 X:104170666-104170688 TTGAAAATATAAAAGAAGGTGGG + Intronic
1195682366 X:107558083-107558105 TTGAAACTATAGATCAATTTGGG + Intronic
1195856835 X:109340996-109341018 CTCAAAGTATATATGAAGTGGGG + Intergenic
1196370174 X:114968822-114968844 CTGAATATATAGATTACTTTGGG - Intergenic
1197539440 X:127738579-127738601 TTGAATGTATAGATCAAGTTGGG - Intergenic
1198141986 X:133813504-133813526 CTGAAAGGATAGGTAAAGTTAGG + Intronic
1198891733 X:141403863-141403885 CTGAAAAGAGAGAGGAAGCTGGG - Intergenic
1199582317 X:149372746-149372768 CTGAAAATATAGCTGGAGGCTGG + Intergenic
1199613786 X:149639516-149639538 TTAAATATATAGATCAAGTTAGG - Intergenic
1199702614 X:150394510-150394532 CTGAATCTATAGATCAAATTGGG + Intronic
1200601843 Y:5215128-5215150 CAGAAAATTTAAATGAAGTTTGG - Intronic
1200853566 Y:7911519-7911541 CTGCCATTATAGATGAAGTTTGG + Intergenic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic
1202332211 Y:23766687-23766709 ATGAAAATATAGATGAAAGACGG + Intergenic
1202538558 Y:25903376-25903398 ATGAAAATATAGATGAAAGACGG - Intergenic