ID: 905378456

View in Genome Browser
Species Human (GRCh38)
Location 1:37541730-37541752
Sequence AGGGGGATACATTTTAAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905378453_905378456 -8 Left 905378453 1:37541715-37541737 CCATACAGTAGTCCCAGGGGGAT 0: 1
1: 0
2: 0
3: 5
4: 63
Right 905378456 1:37541730-37541752 AGGGGGATACATTTTAAGTATGG 0: 1
1: 0
2: 0
3: 17
4: 155
905378448_905378456 19 Left 905378448 1:37541688-37541710 CCTGGTAGAAAATGTTTGCAACA 0: 1
1: 0
2: 7
3: 48
4: 314
Right 905378456 1:37541730-37541752 AGGGGGATACATTTTAAGTATGG 0: 1
1: 0
2: 0
3: 17
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905378456 Original CRISPR AGGGGGATACATTTTAAGTA TGG Intronic
904351502 1:29910018-29910040 AGGAGGCTCCACTTTAAGTAGGG - Intergenic
905378456 1:37541730-37541752 AGGGGGATACATTTTAAGTATGG + Intronic
906729331 1:48067653-48067675 AGGGGGTTAAATATAAAGTAAGG + Intergenic
909236128 1:73154145-73154167 TGGGGGATACCTGTTAACTAAGG - Intergenic
909662708 1:78101626-78101648 AGGGGGAACCATGTTAAGTATGG - Intronic
911990339 1:104688347-104688369 GGGGGGATGCATTTTAAAGAGGG - Intergenic
914136504 1:144905419-144905441 TGGGGCACACATCTTAAGTAGGG - Intronic
914407515 1:147390444-147390466 AGGGCGATACTTTGTAGGTAAGG - Intergenic
915200372 1:154222021-154222043 AGGTGGCTACATTTCAAGAATGG - Intronic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
921789386 1:219272216-219272238 AGGGGGTTGCATTCTAAGTCTGG - Intergenic
922679602 1:227580974-227580996 AGAGTGATACATTTAGAGTATGG + Intronic
922786305 1:228284014-228284036 AGGGTGACACGTTTTATGTACGG - Intronic
923546583 1:234927792-234927814 AGGGAGAGGCATTTTAAATAAGG - Intergenic
923681220 1:236120231-236120253 AGGGGGAGGCATTTTAAGGAGGG + Intergenic
924429134 1:243981703-243981725 TGGGGGATACACTTCAAGAAGGG - Intergenic
1064813967 10:19235202-19235224 AGGGGGACACGTTTGAAGTAGGG + Intronic
1064866685 10:19888604-19888626 CGAGGGATACATTTTAAGTTAGG + Intronic
1065246947 10:23768119-23768141 ATTGGGCTACATTTTAAGAATGG - Intronic
1068439543 10:57033100-57033122 TGGGAGATACATTTCAAGTTGGG - Intergenic
1073722438 10:106188135-106188157 AGAGGTATACATTTCAAGTAAGG + Intergenic
1075251322 10:120877104-120877126 AGAGGTATTAATTTTAAGTAAGG + Intronic
1080791820 11:35528057-35528079 AGGGGGATGCAATTCATGTAGGG - Intronic
1081234658 11:40632970-40632992 AAGGGATTACATTTTAATTAGGG - Intronic
1081620270 11:44615186-44615208 GGGGGGAGGCAGTTTAAGTAGGG + Intronic
1084600566 11:70143019-70143041 AGGGGGTCACATTTCAAGAAGGG + Intronic
1093962531 12:25290805-25290827 TTGGGGATACATTCAAAGTAAGG - Intergenic
1094474499 12:30830995-30831017 AGGAGGAGACATGTGAAGTAAGG - Intergenic
1094804736 12:34078564-34078586 AGAGGAACACATTTTAAATATGG - Intergenic
1095522321 12:43082212-43082234 TGGGGAATACATTTAAACTATGG + Intergenic
1097684586 12:62679507-62679529 AGGGGGATACATGTTTTGTGAGG + Intronic
1100597491 12:96084271-96084293 AAGGGGATTCGTTTTAAGGAAGG + Intergenic
1100655768 12:96643314-96643336 AGGAGGAAACATTTGAAGAAAGG - Intronic
1105631470 13:22173700-22173722 AGGCTGATCCATTTTCAGTAGGG + Intergenic
1106311809 13:28561225-28561247 AAGGGGATATATTTTAATAAGGG - Intergenic
1107230159 13:38099215-38099237 AGGGAGACACATTTGAGGTAAGG + Intergenic
1109253458 13:60049298-60049320 AGGAGGCAACATTTTAAATAGGG + Intronic
1109983836 13:69948501-69948523 CGGGGAATACTTTTTAAATAGGG + Intronic
1110334125 13:74306787-74306809 AGGGGGAAGCATTTGATGTAGGG + Intergenic
1112086601 13:96038769-96038791 AGGGAAATATATTTTATGTAGGG - Intronic
1112605385 13:100899770-100899792 AAGGGGTTTCATTTTAAATAGGG + Intergenic
1112995308 13:105567617-105567639 AGGGGGATACAATCTAAGATGGG + Intergenic
1113078179 13:106488944-106488966 AGAGTGAGACATTTTAGGTAGGG - Intergenic
1113109028 13:106802281-106802303 AAGGGGATTCAGTTTAAGTGGGG + Intergenic
1113339836 13:109411281-109411303 AGCGGTATAACTTTTAAGTACGG + Intergenic
1116587839 14:46732650-46732672 AGGGGGATACATTTTCATTGTGG - Intergenic
1116970676 14:51061593-51061615 AGGGGAATATATTTTCAGTTTGG - Intronic
1117394039 14:55291140-55291162 TGTGGGATACATTTTTAGAAGGG + Intronic
1117771565 14:59138890-59138912 AGAGGAACACATTTTAAGTATGG + Intergenic
1124391035 15:29257721-29257743 AGGGGTATACATTATAGTTACGG - Intronic
1126100944 15:45117877-45117899 GTGGTGATACATTTTAAGTCTGG - Exonic
1128112087 15:65082822-65082844 GGGGAGGTAGATTTTAAGTAGGG - Intergenic
1128581802 15:68815987-68816009 TGGGGGACACATTTTGAGTAAGG - Intronic
1129715885 15:77850353-77850375 AAGGTGATACATTTTATGTTAGG + Intergenic
1130347417 15:83061037-83061059 ATGGAGATACATTCTAAGAAAGG + Intronic
1131548740 15:93338347-93338369 CGGGGGAGACCTTTTGAGTAGGG + Intergenic
1132161357 15:99545972-99545994 AGGGAGATACATGTTAAGCTTGG - Intergenic
1132163013 15:99561148-99561170 AAGTTGATACTTTTTAAGTATGG - Intergenic
1132332615 15:101023220-101023242 TGATGGATTCATTTTAAGTAGGG - Intronic
1135245545 16:20853775-20853797 AGAGGCATACTTTTTAAGTGAGG + Intronic
1137961920 16:52890091-52890113 AGGGGGATACATGTTTCCTATGG - Intergenic
1145119780 17:20247788-20247810 AAGGGGCTACTTTTTAAATAAGG + Intronic
1152977649 18:238411-238433 ACAGGGATACATTCTAAGAAAGG + Intronic
1152990314 18:357785-357807 ATGGGGATACATTCTGAGAATGG + Intronic
1156760903 18:40589056-40589078 AGGGCACTACATTTTAATTAAGG - Intergenic
1157808470 18:50675916-50675938 TGGAAGATACATTTTAAGAAAGG - Intronic
1159591211 18:70337221-70337243 ATGGGGCTACATTTTAACTATGG - Intronic
1159654107 18:71011512-71011534 AGGGGAAGACTTTTTAAATAAGG + Intergenic
1162446217 19:10724478-10724500 GAGGGGGTACATTTTAAATAGGG + Intronic
927343267 2:22007073-22007095 TGGGCGATTCATTTTAAGAATGG - Intergenic
931102900 2:59022253-59022275 GGGGAGATCCATTTTAGGTACGG - Intergenic
931842216 2:66165388-66165410 GGGGAGATTCATTTTAAGTTGGG + Intergenic
932068348 2:68590449-68590471 AGAGAAATACATCTTAAGTAAGG - Intronic
933386163 2:81613260-81613282 AGTGGATTACATTTTAACTATGG + Intergenic
933647931 2:84827464-84827486 AGGGGGATGCACTTGAAGTAAGG - Intronic
933883022 2:86689989-86690011 AGGGAGATTCATTTCAAGAAAGG + Intronic
939338108 2:140857532-140857554 AGGTGTATATATTTTAAATAAGG - Intronic
941613385 2:167689593-167689615 AGGGGGAGCCATTTTAAGGTTGG + Intergenic
942641651 2:178066974-178066996 AAGGGGAAAGATTCTAAGTAGGG - Intronic
942819207 2:180091268-180091290 ATGGGGATACATTCTGAGAAAGG - Intergenic
943111110 2:183607160-183607182 AGGAGAATCCATTTTTAGTAAGG + Intergenic
944189837 2:196991111-196991133 AGGGGGAGACATTTTATGGAGGG + Intronic
944502616 2:200377716-200377738 AGGGGTATACATTTTATTAAGGG - Intronic
944981518 2:205126249-205126271 AAGGGTATACATTTTTAATAAGG - Intronic
945732275 2:213553582-213553604 ATGGGTATACATTTTGAGAAAGG - Intronic
947353319 2:229269315-229269337 AGGGGGAGACATTTCTAGTGAGG + Intronic
948389090 2:237599219-237599241 AGGGGGTCACATTTTCAGCATGG - Intronic
1172861516 20:38057414-38057436 AGGGGCACACATTTTCAGAATGG - Intronic
1173518108 20:43679343-43679365 AAGGGGATAAATTTAAAGTGAGG - Intronic
1178776032 21:35551675-35551697 ATGGGGATAGAATTTAAGTTGGG + Intronic
1182900724 22:33896050-33896072 AGGGGGAGACAGTTTCAGTTTGG - Intronic
1184020478 22:41817889-41817911 AGGGTGATACCTTTTAATTCAGG + Intronic
1184994288 22:48193746-48193768 GGGGGGTTATATTTTAATTATGG - Intergenic
950798646 3:15531657-15531679 AGGGGGAAACATTTAAATTTGGG - Intergenic
950852443 3:16075387-16075409 AGGGGGATACATTTCCAAAAGGG + Intergenic
951959113 3:28295512-28295534 AGTAGGTTACATTTTCAGTAGGG - Intronic
952140129 3:30469123-30469145 ATGGGGATACATTGGAAATAAGG + Intergenic
952205150 3:31173842-31173864 AGGAGGACACAATTTCAGTACGG - Intergenic
955465439 3:59232029-59232051 GTGGGGTTACAATTTAAGTAAGG + Intergenic
964112540 3:153102796-153102818 AGTAGGAAACATTTTAAGGAGGG - Intergenic
964644653 3:158946227-158946249 AGAGGGAAACATTTTATGTAAGG - Intergenic
965412332 3:168347737-168347759 AGGGGAATAAATTTTATTTATGG + Intergenic
965631790 3:170740731-170740753 AGGAGGAAACATTTGAAGAAAGG + Intronic
967385196 3:188904212-188904234 AGGGTGATACATTGTAAAAAAGG + Intergenic
967517710 3:190390197-190390219 ATAGCAATACATTTTAAGTATGG - Intronic
968777505 4:2552493-2552515 TGTGGGATACAGCTTAAGTATGG - Intronic
970042672 4:11813479-11813501 TGGGGTAAACATTTTAAGTCTGG - Intergenic
971571971 4:28224248-28224270 AAGAGGAAACATTCTAAGTAGGG - Intergenic
972072922 4:35044636-35044658 AGGGAAATTCATTTTAGGTACGG + Intergenic
973235136 4:47893540-47893562 AGAGCAATACCTTTTAAGTATGG + Intronic
976799161 4:88968920-88968942 AAGGAGATACACTTTAACTAAGG + Intronic
976850617 4:89541229-89541251 AGGGGGTTACATCTTTACTATGG + Intergenic
980804341 4:137792578-137792600 AGGGGAATACATTCTAAGTTGGG - Intergenic
982206415 4:153000497-153000519 AAGGTGGTACATTTTAAGGACGG - Intergenic
982495781 4:156090646-156090668 AGAAAGATACATTTTAAATAGGG + Intergenic
983610701 4:169641834-169641856 AGGCGGATTCATATTAACTAGGG + Intronic
984276914 4:177622166-177622188 ATGGGGATACATTCTGAGTACGG - Intergenic
987071465 5:14340831-14340853 AAGGGGATGCATTTTACCTAGGG + Intronic
987191144 5:15479616-15479638 AAGGGGGTACATTTTATATAGGG + Intergenic
987940558 5:24530526-24530548 AGGCAGATAGATTTAAAGTATGG + Intronic
988315465 5:29621408-29621430 AGGGGGCCACATTTTCAGGAAGG - Intergenic
990040512 5:51373597-51373619 AGGGAAATACATTAAAAGTAAGG + Intergenic
990979333 5:61587615-61587637 GGGGGGATGAATATTAAGTAGGG + Intergenic
992270980 5:75062631-75062653 AGGAGGGAACATTCTAAGTAGGG + Intergenic
992310766 5:75497382-75497404 AGGGGGATAATGTCTAAGTATGG - Intronic
995524215 5:113037872-113037894 ATGGGGAAACATTTGAAATATGG + Intronic
995861712 5:116647875-116647897 AAGGGGAGAAATTTTAAGTATGG + Intergenic
996314000 5:122141012-122141034 TGGGGGATCCATTTTAGGTTAGG + Intronic
996966248 5:129309488-129309510 AGGGGGATGGATTTTGAGGAGGG + Intergenic
999649140 5:153748502-153748524 AGTGGGACAGATTTTAAGTGGGG + Intronic
1001384532 5:171327968-171327990 AGGGACATCCATTTTAATTATGG - Intergenic
1001816000 5:174670120-174670142 AAGAAGAGACATTTTAAGTAAGG - Intergenic
1008691051 6:53979313-53979335 AGGGGGGTACCTATGAAGTATGG + Intronic
1011637320 6:89386277-89386299 AGGCAGATACATTTTAGGAAGGG - Intronic
1015032986 6:128618280-128618302 AGGCAGATAGATTTTAGGTAGGG + Intergenic
1015435279 6:133179256-133179278 TGGGGGATACATATTAAATCAGG - Intergenic
1016154703 6:140790757-140790779 GGGAGGAAATATTTTAAGTATGG + Intergenic
1016170889 6:141015019-141015041 ACCAGAATACATTTTAAGTATGG + Intergenic
1016710845 6:147170250-147170272 AGGTGGAAACATTTTTTGTAGGG - Intergenic
1021773236 7:24025954-24025976 AGGGGGTAGCATTCTAAGTAAGG + Intergenic
1022165142 7:27752022-27752044 TGAGGGATAGTTTTTAAGTAAGG + Intronic
1030375380 7:108747353-108747375 AGAGGAATACATTTTTAGAAAGG + Intergenic
1031729359 7:125278802-125278824 AGAGGGAGACATTTGAAGCAGGG + Intergenic
1032376739 7:131427518-131427540 AGGGGGAAATATTTGAAGAAAGG + Intronic
1032598973 7:133272680-133272702 AAGAGGATACATTTTAAATATGG + Intronic
1036539498 8:9691057-9691079 AGGGTGTCACATTTTAAGAAGGG + Intronic
1037949555 8:23010007-23010029 AGTGGGATACAGAATAAGTAAGG - Intronic
1038918842 8:32059278-32059300 AGGGGGATATATTTGGAGTGGGG - Intronic
1039171691 8:34754472-34754494 AAGGGGATATGTTTTCAGTAGGG + Intergenic
1042788293 8:72574060-72574082 TGGATGATACATTTTAAGAAAGG - Intronic
1042929095 8:73995986-73996008 AGGGGGTTGCATTTTAAATCAGG + Intronic
1044790468 8:95841671-95841693 AGGAGGATCCATTTTTTGTAAGG - Intergenic
1046815192 8:118575606-118575628 ATGGGGATACATTTTTATAAAGG + Intronic
1048715756 8:137266975-137266997 AGAGAGATACATTTTACTTATGG + Intergenic
1048822432 8:138392403-138392425 AGGGGGATATATTTTAAAGCAGG + Intronic
1049302379 8:141878481-141878503 CGGGGGATGCATTTGAAGAAGGG - Intergenic
1050103845 9:2145355-2145377 AAGGAGAGATATTTTAAGTAAGG + Intronic
1051790117 9:20792454-20792476 ATGGGGATACGTTTTGAGGAAGG - Intronic
1059315811 9:113424950-113424972 TGGGGGATACATTTGGAGAAAGG + Intronic
1059573298 9:115463714-115463736 AGAGGGGTACATATTAAGGAGGG + Intergenic
1186791140 X:13000188-13000210 AGAGAGGTACATTTTAAGTAAGG + Intergenic
1187983381 X:24783702-24783724 ATTGGGATATATTTTAAGAATGG - Intronic
1190526487 X:51333500-51333522 GGCGGGATGCATTTTAAGCAAGG - Intronic
1190585006 X:51931232-51931254 AAGGGGAAATATTTGAAGTAGGG + Intergenic
1193526999 X:82604312-82604334 AGGGGGGTACATGTTAATTTTGG - Intergenic
1194295959 X:92126755-92126777 AGGGGAAAAAATTTAAAGTATGG + Intronic
1196740086 X:119017131-119017153 TGAGGGAGACATTTTAAGGATGG - Intronic
1197607630 X:128603666-128603688 AGAGGGATAGATTTTAAATTTGG - Intergenic
1198644564 X:138791904-138791926 ATGGGCAAACATTTTAACTATGG - Intronic
1199333069 X:146584622-146584644 TGGGGGATACATTTTAAAGGTGG - Intergenic
1200613463 Y:5351358-5351380 AGGGGAAAAAATTTAAAGTATGG + Intronic
1201613773 Y:15872844-15872866 AGAGGGATACATTCTGAGAAAGG - Intergenic