ID: 905379891

View in Genome Browser
Species Human (GRCh38)
Location 1:37554300-37554322
Sequence AACTCCTGGACTTCCGCTTC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 93}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905379889_905379891 4 Left 905379889 1:37554273-37554295 CCTCTAGCTGGAGGAAATGACGA 0: 1
1: 0
2: 0
3: 5
4: 92
Right 905379891 1:37554300-37554322 AACTCCTGGACTTCCGCTTCCGG 0: 1
1: 0
2: 0
3: 4
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905379891 Original CRISPR AACTCCTGGACTTCCGCTTC CGG Exonic
903008081 1:20311604-20311626 AACTCCTCTCCTTCCACTTCAGG + Intronic
903295908 1:22342959-22342981 ACCTCCTGGACTCCCACTCCAGG + Intergenic
903917141 1:26772869-26772891 GAGTCATGGAATTCCGCTTCTGG - Exonic
905379891 1:37554300-37554322 AACTCCTGGACTTCCGCTTCCGG + Exonic
908569077 1:65389785-65389807 AACTCCTGGCCTTCCTATCCTGG - Intronic
909040480 1:70643367-70643389 AACCCTTGGAATTCCTCTTCAGG - Intergenic
910100259 1:83568228-83568250 AGCTCCTGACCTTCGGCTTCTGG + Intergenic
911644353 1:100322196-100322218 AACTCCTGGCCTTGAGCTCCTGG + Intergenic
915850215 1:159313858-159313880 AACTCTGGGACTTAGGCTTCAGG + Exonic
915857529 1:159405575-159405597 AACTCTGGGACTTAAGCTTCAGG + Intergenic
918151665 1:181802316-181802338 AACATTTGGACTTCAGCTTCTGG - Intronic
920930063 1:210379668-210379690 AACTCCTGGAGTTGTGTTTCTGG + Intronic
921104307 1:211960165-211960187 AACTCCTGGACTACCTGCTCTGG - Intronic
921816508 1:219569892-219569914 AACTCCTGGACTTAAGCCACAGG - Intergenic
924673299 1:246150701-246150723 AACCCCTGGACTTCCACGGCTGG - Intronic
1074698255 10:116070420-116070442 GAGTTCTGGACTTCTGCTTCTGG - Intronic
1076834684 10:133015053-133015075 AAGTCCTGGGCGTCCGCTGCAGG + Intergenic
1077080333 11:722131-722153 AGCTCGTGCACTTCCTCTTCGGG + Exonic
1077611669 11:3646750-3646772 ACCTCTTGGACATCTGCTTCAGG + Intronic
1079238226 11:18704598-18704620 AACTGCTGGACTTCCTATGCAGG + Exonic
1079513157 11:21234761-21234783 AACCTCTGGCCTTCTGCTTCTGG - Intronic
1084031590 11:66484467-66484489 AACTCCTGGAGCTCCCCTCCAGG - Intronic
1098766003 12:74489673-74489695 AACTGGTGGACTTTCTCTTCTGG + Intergenic
1102283776 12:111638605-111638627 CACTCTTGGACTTCCCCTCCTGG + Intergenic
1107962918 13:45574921-45574943 AACTCCAGGACTTTCGATTTTGG + Exonic
1110983131 13:81928360-81928382 AACTCCTGGACTCACCCTCCTGG - Intergenic
1113558824 13:111260124-111260146 AACTCCTGGATTTGCCCTTTTGG - Intronic
1119202397 14:72766210-72766232 ATCTCAGGGACTTCTGCTTCTGG + Intronic
1121288269 14:92753479-92753501 AACACATTGACTTCTGCTTCTGG - Intergenic
1121313612 14:92948440-92948462 AACTCCTGGGCCTCAGCCTCTGG + Intronic
1121400168 14:93669167-93669189 AAATCCTGGATTTTCTCTTCTGG + Intronic
1124151458 15:27182543-27182565 CACCCCTGGGCTTCCGCTCCTGG + Intronic
1130339353 15:82986195-82986217 AACCACCTGACTTCCGCTTCCGG - Exonic
1141151123 16:81565340-81565362 AACTCCTGGAGTTGGGCTGCTGG - Intronic
1143771988 17:9174822-9174844 CAGTCCTGAAGTTCCGCTTCTGG - Intronic
1148859964 17:50599658-50599680 AACTCTTGGCCTCCCGCTCCAGG - Exonic
1153247974 18:3092283-3092305 AACTCCTGGACTGAAGCCTCAGG + Intronic
1157594632 18:48857114-48857136 GACTCCTGGACTTCCTCCTGTGG + Intronic
1158371886 18:56816087-56816109 TCCTCCTGGACTTTTGCTTCAGG - Exonic
1164742758 19:30588788-30588810 TACTCCTGGGCTTCCGTTTATGG + Intronic
1164916707 19:32057964-32057986 AAGTGCTGGTCTTCCACTTCTGG - Intergenic
1166695749 19:44850762-44850784 AGCTCCTGGATTTCCGCTGTGGG + Intronic
931717476 2:65040534-65040556 AACTCCTTGACTTTCAGTTCTGG - Intergenic
933067802 2:77819765-77819787 GACTCCTGGACTTACACTACTGG + Intergenic
937922574 2:127141593-127141615 ACCTCCCGGGCTTCTGCTTCTGG + Intergenic
939571545 2:143846063-143846085 GACTCCAGGACTTACGCTTTTGG + Intergenic
940144664 2:150533508-150533530 AATTCCTGGGCTTGAGCTTCTGG + Intronic
1174734596 20:52953937-52953959 AGCTCCTGTACTTCCTCTTCAGG + Intergenic
1174864477 20:54122464-54122486 AACTCATGAACTTCAGTTTCTGG + Intergenic
1178675261 21:34626075-34626097 AACCCCTGGACTGCGACTTCAGG + Intergenic
1180995117 22:19961710-19961732 AACCCCTGGGCTTCTGCCTCAGG + Intronic
951140293 3:19149943-19149965 AAGTCTTGGACTTATGCTTCAGG + Intronic
956107138 3:65831636-65831658 GACTCCTGGTCTTACGATTCAGG + Intronic
964872252 3:161325932-161325954 ACCACCTGGGCTTCTGCTTCTGG + Intergenic
966095260 3:176192960-176192982 AAATCTTGGACTGCCACTTCTGG + Intergenic
967571961 3:191039905-191039927 AGGTCCTGGACTTTCGCTACTGG + Intergenic
970574735 4:17416373-17416395 CACTCCTGGAGAGCCGCTTCTGG + Intergenic
975828245 4:78341925-78341947 AACTCCAGGACTTTAGGTTCAGG - Intronic
978553231 4:109950299-109950321 AACTCCTCGGTTTCCGCTTTGGG - Intronic
981430117 4:144647485-144647507 AACTCCTGGTCCTCCGGTTAGGG + Intronic
984942334 4:184943775-184943797 ATCTCCTGGACCTCAGCTACTGG - Intergenic
1003350832 6:5316555-5316577 TGCTCTTGGACTTCTGCTTCCGG - Intronic
1004331747 6:14728406-14728428 TTCTCCAGCACTTCCGCTTCAGG - Intergenic
1012925686 6:105264860-105264882 AACTCCTGGTCTTCAGCAGCAGG - Intergenic
1016505177 6:144771345-144771367 AACTCCTGGGCTCCCACCTCAGG + Intronic
1017751348 6:157492738-157492760 ACCTCCTGGTCTTCCCCTCCCGG - Intronic
1018260120 6:161961945-161961967 AACTCTTGAAATTCCACTTCCGG + Intronic
1018692110 6:166354820-166354842 AATGCCTGGACTTCTGCTGCTGG + Intergenic
1019316405 7:388929-388951 AAATCCTGGCCTTTGGCTTCAGG + Intergenic
1031204656 7:118741269-118741291 ACCTCTTGGACTTACTCTTCTGG - Intergenic
1033055002 7:138043436-138043458 AATGCTTGGACTTCCGCTTCTGG + Intronic
1033772125 7:144564339-144564361 AACTGATGGACTTTGGCTTCGGG - Intronic
1034162241 7:149002257-149002279 AACGAATGGACTTCTGCTTCCGG + Intergenic
1034173545 7:149082277-149082299 AACTCTTAGTCTTCTGCTTCTGG - Intronic
1034861268 7:154597016-154597038 AAGTCCTTGACTTCTTCTTCTGG - Intronic
1039721196 8:40166284-40166306 AAATCCTGTAATTCCACTTCTGG + Intergenic
1043716226 8:83490275-83490297 AACTCTTGGACTTACACTTGTGG - Intergenic
1047136696 8:122087346-122087368 AACTCCTGTAACTCCTCTTCTGG - Intergenic
1048360547 8:133693925-133693947 ATCTTCTGCACTTCAGCTTCTGG - Intergenic
1052735758 9:32340754-32340776 AACTCCTGGGCTTCCACCTCTGG - Intergenic
1053072786 9:35111121-35111143 GACTCCTGGACTCCTTCTTCTGG + Exonic
1056898891 9:90580426-90580448 AACACCTTGACTGCAGCTTCCGG - Intergenic
1057338196 9:94174228-94174250 CCCTCCTGGACTTCAGCTTAAGG - Intergenic
1058025399 9:100137358-100137380 AACTCCTAAACTTGGGCTTCAGG + Intronic
1058944670 9:109845174-109845196 AGCTCCTGGGCTTCCCTTTCAGG - Intronic
1061917496 9:133762966-133762988 AACTCCTGGCCTTCGACTTCTGG - Exonic
1062425780 9:136505597-136505619 ACATCCTGGACTACAGCTTCGGG - Exonic
1062430595 9:136525374-136525396 ACCTCCTGGCCTTGCGCTCCGGG + Intronic
1186600409 X:11030581-11030603 AACACCAGGGCTTCCTCTTCTGG - Intergenic
1186875325 X:13810821-13810843 ATCCCCTGGACTTACACTTCTGG + Intronic
1189886803 X:45554684-45554706 AACTGCTGGATTTCTACTTCTGG - Intergenic
1192194147 X:69017492-69017514 ATCTCCTGGCCTTCACCTTCAGG + Intergenic
1192599958 X:72451701-72451723 AACTAAAGGACTTCGGCTTCTGG + Intronic
1194530738 X:95045421-95045443 AGCTCTTGGATTTCCACTTCTGG + Intergenic
1200251619 X:154557181-154557203 AACGCGTGGCCTCCCGCTTCTGG + Intronic
1200253826 X:154568865-154568887 AACGCGTGGCCTCCCGCTTCTGG + Intergenic
1200263943 X:154635543-154635565 AACGCGTGGCCTCCCGCTTCTGG - Intergenic
1200266148 X:154647235-154647257 AACGCGTGGCCTCCCGCTTCTGG - Intergenic