ID: 905385456

View in Genome Browser
Species Human (GRCh38)
Location 1:37600381-37600403
Sequence GGCTCAGAATATACATCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905385448_905385456 24 Left 905385448 1:37600334-37600356 CCTAGTCCCCAAATGCTAGGTTC No data
Right 905385456 1:37600381-37600403 GGCTCAGAATATACATCTTCAGG No data
905385453_905385456 16 Left 905385453 1:37600342-37600364 CCAAATGCTAGGTTCTGGGACTC No data
Right 905385456 1:37600381-37600403 GGCTCAGAATATACATCTTCAGG No data
905385452_905385456 17 Left 905385452 1:37600341-37600363 CCCAAATGCTAGGTTCTGGGACT No data
Right 905385456 1:37600381-37600403 GGCTCAGAATATACATCTTCAGG No data
905385451_905385456 18 Left 905385451 1:37600340-37600362 CCCCAAATGCTAGGTTCTGGGAC No data
Right 905385456 1:37600381-37600403 GGCTCAGAATATACATCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905385456 Original CRISPR GGCTCAGAATATACATCTTC AGG Intergenic
No off target data available for this crispr