ID: 905386430

View in Genome Browser
Species Human (GRCh38)
Location 1:37607363-37607385
Sequence GTGAACAGTGATAAGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905386430_905386439 15 Left 905386430 1:37607363-37607385 CCTCCCACCTTATCACTGTTCAC No data
Right 905386439 1:37607401-37607423 TTGCCCATTTAAATCTGGTCTGG No data
905386430_905386442 26 Left 905386430 1:37607363-37607385 CCTCCCACCTTATCACTGTTCAC No data
Right 905386442 1:37607412-37607434 AATCTGGTCTGGACCACAGCTGG No data
905386430_905386437 10 Left 905386430 1:37607363-37607385 CCTCCCACCTTATCACTGTTCAC No data
Right 905386437 1:37607396-37607418 ACCTGTTGCCCATTTAAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905386430 Original CRISPR GTGAACAGTGATAAGGTGGG AGG (reversed) Intergenic
No off target data available for this crispr