ID: 905386995

View in Genome Browser
Species Human (GRCh38)
Location 1:37611921-37611943
Sequence CCCGGCAGCAGTGTTGTCAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 122}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905386995_905386998 -3 Left 905386995 1:37611921-37611943 CCTGTGACAACACTGCTGCCGGG 0: 1
1: 0
2: 0
3: 15
4: 122
Right 905386998 1:37611941-37611963 GGGCCATGCTCTGAGTAACAAGG 0: 1
1: 0
2: 2
3: 18
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905386995 Original CRISPR CCCGGCAGCAGTGTTGTCAC AGG (reversed) Exonic
901231495 1:7644073-7644095 CCCGCCAGCGGAGTTGTCAGCGG + Intronic
902623458 1:17663596-17663618 CCTGGCAGCAGTGGTGTTTCTGG + Intronic
905386995 1:37611921-37611943 CCCGGCAGCAGTGTTGTCACAGG - Exonic
907746999 1:57223484-57223506 CACGGCTGCAGTCTGGTCACTGG - Intronic
923284617 1:232481361-232481383 CCTGACAGCAGTGTTGTGATGGG - Intronic
924795799 1:247291385-247291407 CCACGCAGCAGTGTTGAGACTGG + Intergenic
1063295099 10:4797275-4797297 GCCTGCAGCAGTGCTGTGACTGG + Intronic
1070583776 10:77745346-77745368 CCAGGCTGAAGTGTAGTCACAGG - Intergenic
1071575952 10:86726523-86726545 CTCACCAGCAGTGTTGTCAGCGG + Intronic
1072668082 10:97409007-97409029 CCCTGCAGCAGTGCTGTGCCAGG - Intronic
1074135902 10:110626161-110626183 TCAGGCAGCAGTGGTGTCAAGGG - Intergenic
1075746261 10:124729997-124730019 CACGGCATCAGTGTTGGCAGTGG + Intronic
1079237070 11:18698717-18698739 CCTGGCAGCGGTGACGTCACGGG + Intronic
1083644374 11:64164264-64164286 CTGGGCTGCTGTGTTGTCACTGG - Intronic
1087009645 11:93501171-93501193 CCCAGCAGCAGAGTTGGCACTGG - Intronic
1087652012 11:100878791-100878813 CCAGGAAGCAGTGTTGTAATGGG - Intronic
1093376079 12:18429566-18429588 CAGGGCAGCAGTGGTGTCAAGGG - Intronic
1100491586 12:95085010-95085032 CCCTACAGCAGTGTTTTCATAGG + Intronic
1102008144 12:109601810-109601832 CCATGCGGCAGGGTTGTCACAGG + Intergenic
1102051089 12:109862436-109862458 CCTGGCAGCACTGTAGTCACTGG - Intronic
1104963835 12:132500367-132500389 CTCGCCAGCAGTGTAGACACGGG - Intronic
1105548058 13:21366129-21366151 CCCAGCAGAAGTGTTGTCAGTGG - Intergenic
1107552909 13:41493833-41493855 TCCGGCACCAGTGTTGGCTCTGG - Intergenic
1125825968 15:42676770-42676792 CCCAACACCAGTGATGTCACAGG - Intronic
1127012287 15:54643690-54643712 CCCAGCAGCAGTGGAGTCTCTGG + Intergenic
1127516399 15:59697562-59697584 CCCAGCAGCAGTTTTGTCTTTGG + Intergenic
1129832731 15:78681354-78681376 CCCGGCAACAATGGTGTCTCTGG - Intronic
1132403196 15:101526435-101526457 CCGGGCAGCTGTCTTGTCCCAGG - Intergenic
1132867736 16:2102256-2102278 CCCGGCGGCTGTGTCCTCACAGG - Exonic
1132888342 16:2192363-2192385 CCTGGCAGCACTGGTCTCACTGG + Intronic
1133430545 16:5733463-5733485 CCGAGCAGCAGTGCTGTCAGTGG + Intergenic
1134548862 16:15130077-15130099 CCCGGCGGCTGTGTCCTCACAGG - Intronic
1134719485 16:16372642-16372664 CCCGGCGGCTGTGTCTTCACAGG + Intergenic
1134947941 16:18339243-18339265 CCCGGCGGCTGTGTCTTCACAGG - Intergenic
1138226806 16:55302877-55302899 CCCGGAAGAAGTGTTGACAATGG - Intergenic
1138504889 16:57473361-57473383 CTCGCCAGCACTGTGGTCACTGG + Exonic
1141705192 16:85661008-85661030 CCCTGCAGCCCTGTTGGCACTGG + Intronic
1143680557 17:8472891-8472913 CCCAGCAGCAGTGTGGTTCCCGG - Intronic
1144533317 17:16061825-16061847 ATCCGCAGCAGTGTTGTAACGGG + Exonic
1145852299 17:28112341-28112363 CCCAGCAGCTTCGTTGTCACAGG - Intronic
1146456510 17:33013591-33013613 ACGGGCAGCAGTGTGGACACTGG + Exonic
1146849764 17:36212011-36212033 CCTGACAGCAGTGAGGTCACAGG + Intronic
1149261585 17:54885900-54885922 TCCAGAAGCATTGTTGTCACAGG - Intergenic
1150212322 17:63447922-63447944 CCTGCCAGCAGTGTTCTCAAGGG + Intergenic
1150311322 17:64131012-64131034 CTCGGCAGCTGTTTGGTCACTGG + Intergenic
1150676082 17:67246230-67246252 CCCGGCAGCAGTGTGGCCGGCGG - Intergenic
1151288456 17:73131037-73131059 CCAGGCAGCAGAGCTCTCACGGG - Intergenic
1151820684 17:76495139-76495161 CCCGGCAGCCGGGTTTTCACGGG + Intronic
1152390984 17:80003442-80003464 GCCGGCGGCACTGGTGTCACTGG + Intronic
1156463130 18:37332792-37332814 CCCAGCAGCAGCATGGTCACGGG - Intronic
1160596902 18:79982097-79982119 CGGGGCGGCAGTGTGGTCACGGG + Intronic
1164985789 19:32647526-32647548 CCCGGCCACAGTGTCCTCACTGG + Intronic
1165138946 19:33687849-33687871 CCCGGCTGAAGTATTGTCCCTGG + Intronic
1168406822 19:56114819-56114841 CCGGGCAGCAGTGTTGGTTCCGG - Intronic
925404111 2:3594986-3595008 CCCGGCCGCAGCGTTATCTCGGG - Intronic
933339311 2:81002424-81002446 CCTGGCAGCAGAGTTTTCAGTGG - Intergenic
933809067 2:86021226-86021248 GCCCGCTGCAGTGTTTTCACGGG - Exonic
934929761 2:98412200-98412222 CCAGAGAGCAGAGTTGTCACTGG - Intergenic
935782694 2:106521876-106521898 CCAGACACCAGTGTTTTCACAGG - Intergenic
935848060 2:107187913-107187935 TCTTGCAGCAGTGTTGGCACAGG - Intergenic
936745789 2:115574841-115574863 CTCTGCAGCAGTGTTGTCCGTGG + Intronic
937070136 2:119056986-119057008 CCTGGAAGCACTATTGTCACAGG - Intergenic
938985614 2:136572555-136572577 CCTGGCAGCAGAGTTGGCACTGG - Intergenic
939199639 2:139018194-139018216 TCCTGCAGCAGTGTTGTTTCAGG + Intergenic
943153001 2:184138194-184138216 TCTGGCAGAAGTGTTGGCACAGG + Intergenic
943455623 2:188103385-188103407 ACTGGCAGCAGTGTTGGCACTGG - Intergenic
944465663 2:199997222-199997244 CCAGGCAGCAGTTTTATCATAGG + Intronic
948153404 2:235762990-235763012 CCGGGTGGCAGTGTTGTCAGTGG - Intronic
948595820 2:239078762-239078784 CCCGCCAGCAGGGATGCCACGGG + Intronic
1173066379 20:39717010-39717032 CCTGACAGCAGTGTGGACACAGG + Intergenic
1176515377 21:7779806-7779828 CCCTGAAGCAGTGTTCTCCCTGG - Intergenic
1177570451 21:22879151-22879173 GCCCACAGCAGTGTTGGCACTGG + Intergenic
1178649405 21:34409818-34409840 CCCTGAAGCAGTGTTCTCCCTGG - Intergenic
1180155486 21:45975302-45975324 CCCGGCTGCAGTGCTGAGACTGG - Intergenic
1180670695 22:17550368-17550390 CATGGCAGCAATGTTGACACAGG - Intronic
1181100715 22:20537059-20537081 CCCTGCAGCGGTGGAGTCACTGG + Intronic
1182630676 22:31682890-31682912 GCCAGCTGCAGTGTTGTCAGGGG - Exonic
1183054489 22:35295223-35295245 CTCCCCACCAGTGTTGTCACAGG + Exonic
1184452549 22:44591626-44591648 GTCGGCAGCAGTGTGGTCACAGG - Intergenic
950177333 3:10884029-10884051 CCCGGCACCACTGTTGTCATTGG - Intronic
950718241 3:14864703-14864725 CCCTGCAGCAGTGCTGTGAGGGG + Intronic
950967419 3:17155830-17155852 CCAGGCAGAAGGGTTGTCCCTGG - Intergenic
952326604 3:32325928-32325950 CCCAGGAGCAGTGCTGTCAGTGG + Intronic
953490737 3:43348052-43348074 CCCACCAGCATTGTTCTCACTGG - Exonic
958840156 3:99193539-99193561 CCCGGCAGCAGACTTTTCAGTGG + Intergenic
959338748 3:105100320-105100342 CCCTGCAGCAGTGTTTTGAATGG - Intergenic
963154358 3:142079684-142079706 CCCGGCAGCAGACTTTTCAGTGG + Intronic
964494698 3:157275738-157275760 CCCAGAAGCAGTGTTTTCAAGGG - Intronic
969340343 4:6536589-6536611 CCCCGCAGGAGTGTTATCAGTGG + Intronic
973617266 4:52691550-52691572 ACTGGCAGCAATGTTGTCATGGG - Intergenic
975909319 4:79248726-79248748 GCAGGCAGCAGTATTGGCACGGG - Intronic
976776979 4:88718080-88718102 CAGGGCAGCAGTGTTGTTTCAGG - Intergenic
977648281 4:99439251-99439273 CGCTGCAGCAGTGTGGTCAGGGG + Intergenic
977918845 4:102622276-102622298 CCCTGCTGCAGTGTTGTTACTGG - Intergenic
984693298 4:182753335-182753357 CCTGTCACCCGTGTTGTCACTGG + Intronic
986686096 5:10276319-10276341 CCCTGTAGCAGGGTAGTCACTGG - Intronic
987089905 5:14501496-14501518 CCAGCTAGCACTGTTGTCACAGG - Intronic
988730437 5:33967469-33967491 CCCAGCAGCATTGGTGTCAGTGG - Intronic
989086785 5:37685096-37685118 TCTGGCAGCAGTGTTGGCACTGG + Intronic
999347531 5:150837377-150837399 CTCGCCAGCAGTTTTGCCACAGG + Intergenic
1003495055 6:6656483-6656505 CCAGGAAGCAGGGTTGTCAGGGG + Intergenic
1008059823 6:46985251-46985273 CCCTGCACCAGTGGTGGCACGGG + Intergenic
1013737946 6:113249046-113249068 TCTGGCAGCAGTGTTGGCACAGG - Intergenic
1014561279 6:122893894-122893916 GGCGGCAGCAGTGTCTTCACAGG - Intergenic
1017914798 6:158823282-158823304 CCCGGCACCAGTGTGGAGACAGG - Intergenic
1026382887 7:69817139-69817161 CTCAACAGCAGTGCTGTCACTGG - Intronic
1026473703 7:70716214-70716236 CCAGTCACCAGTGTTCTCACAGG - Intronic
1032608481 7:133385069-133385091 CCTTGCAGCAGCGTTGTCTCAGG + Intronic
1033305578 7:140223116-140223138 CTCGACCCCAGTGTTGTCACCGG - Intergenic
1034138217 7:148791658-148791680 CCTGGAAGCAGTGTTGTCTGTGG + Intronic
1038809995 8:30830706-30830728 CCTGTCAACAGTGTTGTCATTGG - Intergenic
1041883166 8:62777047-62777069 CCTGGCAGCAGACTTGTCAGTGG - Intronic
1042976681 8:74478074-74478096 GCTGGCAGCAGTGTTAGCACAGG + Intronic
1049023495 8:139973282-139973304 CCCAGCAGCAGGGTGGCCACGGG + Intronic
1049058439 8:140257332-140257354 CCACGCAGCAGTGCTGGCACTGG + Intronic
1049243135 8:141548796-141548818 CCCGCCAGCACTGTCCTCACAGG + Intergenic
1053530853 9:38879397-38879419 ACTGGCAGCAGTGTTGGCACAGG - Intergenic
1054203076 9:62103830-62103852 ACTGGCAGCAGTGTTGGCACAGG - Intergenic
1054635287 9:67484535-67484557 ACTGGCAGCAGTGTTGGCACAGG + Intergenic
1057218193 9:93241109-93241131 TCAGGCAGCAGTGTTGGCCCTGG - Intronic
1059808369 9:117828965-117828987 CTTGGCAGCAGTGTGGTGACAGG + Intergenic
1062627059 9:137448134-137448156 CCCTGCAGCAGTGACCTCACAGG + Exonic
1186459837 X:9739543-9739565 CCCGGAAGCAGGGTTTTCATGGG + Exonic
1187004007 X:15213854-15213876 CCCAGCCGCAGTGCTGTCCCAGG - Intergenic
1187644192 X:21328658-21328680 ACTGGCAGCAGCGTTGGCACAGG - Intergenic
1189035629 X:37491823-37491845 CCCGGTGGTAGTGTGGTCACAGG - Intronic
1191177154 X:57516594-57516616 CCTGGCAGCAGTGTTGATATGGG + Intergenic
1191225700 X:58040610-58040632 CCCAGCAGCAGTGTTGGTGCAGG - Intergenic
1192083542 X:68071427-68071449 CCCAGCAGCTGGGTTGGCACAGG + Intronic
1193149900 X:78114063-78114085 CCCAGCAGCTGGGTTGGCACAGG - Exonic
1193250812 X:79288924-79288946 TCTGGTAGCAGTGTTGGCACAGG - Intergenic
1193706231 X:84823537-84823559 CCCTGCAGCAGTGTTCTTCCTGG + Intergenic
1193749602 X:85326324-85326346 CCCGGCAGTGGTGTTAGCACAGG + Intronic
1195548428 X:106139017-106139039 TCCACCAGCAGTGTTGGCACGGG - Intergenic
1196096534 X:111806916-111806938 CCTGGCAGCAGACTTGTCAGTGG - Intronic
1198891582 X:141403067-141403089 TCCAGCAGCAGTGTTGGCACAGG + Intergenic
1200204207 X:154304157-154304179 CCCGGCAGCAGAGGAGTAACAGG - Intronic
1201968325 Y:19762921-19762943 GCTGGCAGCAGTGTTGTTTCAGG + Intergenic