ID: 905390965

View in Genome Browser
Species Human (GRCh38)
Location 1:37635000-37635022
Sequence GCAAGGACGTGTGGACTCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 97}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905390965_905390972 8 Left 905390965 1:37635000-37635022 CCCGGGAGTCCACACGTCCTTGC 0: 1
1: 0
2: 0
3: 6
4: 97
Right 905390972 1:37635031-37635053 GGCGCTCTGCGCTCCGAGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 69
905390965_905390974 10 Left 905390965 1:37635000-37635022 CCCGGGAGTCCACACGTCCTTGC 0: 1
1: 0
2: 0
3: 6
4: 97
Right 905390974 1:37635033-37635055 CGCTCTGCGCTCCGAGCGCGGGG 0: 1
1: 0
2: 1
3: 5
4: 67
905390965_905390977 20 Left 905390965 1:37635000-37635022 CCCGGGAGTCCACACGTCCTTGC 0: 1
1: 0
2: 0
3: 6
4: 97
Right 905390977 1:37635043-37635065 TCCGAGCGCGGGGCTGGCGGAGG 0: 1
1: 0
2: 2
3: 24
4: 254
905390965_905390973 9 Left 905390965 1:37635000-37635022 CCCGGGAGTCCACACGTCCTTGC 0: 1
1: 0
2: 0
3: 6
4: 97
Right 905390973 1:37635032-37635054 GCGCTCTGCGCTCCGAGCGCGGG 0: 1
1: 0
2: 0
3: 4
4: 71
905390965_905390979 21 Left 905390965 1:37635000-37635022 CCCGGGAGTCCACACGTCCTTGC 0: 1
1: 0
2: 0
3: 6
4: 97
Right 905390979 1:37635044-37635066 CCGAGCGCGGGGCTGGCGGAGGG 0: 1
1: 0
2: 2
3: 27
4: 212
905390965_905390976 17 Left 905390965 1:37635000-37635022 CCCGGGAGTCCACACGTCCTTGC 0: 1
1: 0
2: 0
3: 6
4: 97
Right 905390976 1:37635040-37635062 CGCTCCGAGCGCGGGGCTGGCGG 0: 1
1: 0
2: 2
3: 33
4: 197
905390965_905390975 14 Left 905390965 1:37635000-37635022 CCCGGGAGTCCACACGTCCTTGC 0: 1
1: 0
2: 0
3: 6
4: 97
Right 905390975 1:37635037-37635059 CTGCGCTCCGAGCGCGGGGCTGG 0: 1
1: 0
2: 1
3: 23
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905390965 Original CRISPR GCAAGGACGTGTGGACTCCC GGG (reversed) Intergenic