ID: 905390967

View in Genome Browser
Species Human (GRCh38)
Location 1:37635009-37635031
Sequence CAGCTTCGGGCAAGGACGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 71}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905390967_905390974 1 Left 905390967 1:37635009-37635031 CCACACGTCCTTGCCCGAAGCTG 0: 1
1: 0
2: 0
3: 9
4: 71
Right 905390974 1:37635033-37635055 CGCTCTGCGCTCCGAGCGCGGGG 0: 1
1: 0
2: 1
3: 5
4: 67
905390967_905390976 8 Left 905390967 1:37635009-37635031 CCACACGTCCTTGCCCGAAGCTG 0: 1
1: 0
2: 0
3: 9
4: 71
Right 905390976 1:37635040-37635062 CGCTCCGAGCGCGGGGCTGGCGG 0: 1
1: 0
2: 2
3: 33
4: 197
905390967_905390979 12 Left 905390967 1:37635009-37635031 CCACACGTCCTTGCCCGAAGCTG 0: 1
1: 0
2: 0
3: 9
4: 71
Right 905390979 1:37635044-37635066 CCGAGCGCGGGGCTGGCGGAGGG 0: 1
1: 0
2: 2
3: 27
4: 212
905390967_905390980 25 Left 905390967 1:37635009-37635031 CCACACGTCCTTGCCCGAAGCTG 0: 1
1: 0
2: 0
3: 9
4: 71
Right 905390980 1:37635057-37635079 TGGCGGAGGGACAAGTCCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 112
905390967_905390972 -1 Left 905390967 1:37635009-37635031 CCACACGTCCTTGCCCGAAGCTG 0: 1
1: 0
2: 0
3: 9
4: 71
Right 905390972 1:37635031-37635053 GGCGCTCTGCGCTCCGAGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 69
905390967_905390973 0 Left 905390967 1:37635009-37635031 CCACACGTCCTTGCCCGAAGCTG 0: 1
1: 0
2: 0
3: 9
4: 71
Right 905390973 1:37635032-37635054 GCGCTCTGCGCTCCGAGCGCGGG 0: 1
1: 0
2: 0
3: 4
4: 71
905390967_905390975 5 Left 905390967 1:37635009-37635031 CCACACGTCCTTGCCCGAAGCTG 0: 1
1: 0
2: 0
3: 9
4: 71
Right 905390975 1:37635037-37635059 CTGCGCTCCGAGCGCGGGGCTGG 0: 1
1: 0
2: 1
3: 23
4: 171
905390967_905390977 11 Left 905390967 1:37635009-37635031 CCACACGTCCTTGCCCGAAGCTG 0: 1
1: 0
2: 0
3: 9
4: 71
Right 905390977 1:37635043-37635065 TCCGAGCGCGGGGCTGGCGGAGG 0: 1
1: 0
2: 2
3: 24
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905390967 Original CRISPR CAGCTTCGGGCAAGGACGTG TGG (reversed) Intergenic