ID: 905390969

View in Genome Browser
Species Human (GRCh38)
Location 1:37635017-37635039
Sequence CAGAGCGCCAGCTTCGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 131}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905390969_905390975 -3 Left 905390969 1:37635017-37635039 CCTTGCCCGAAGCTGGCGCTCTG 0: 1
1: 0
2: 0
3: 10
4: 131
Right 905390975 1:37635037-37635059 CTGCGCTCCGAGCGCGGGGCTGG 0: 1
1: 0
2: 1
3: 23
4: 171
905390969_905390974 -7 Left 905390969 1:37635017-37635039 CCTTGCCCGAAGCTGGCGCTCTG 0: 1
1: 0
2: 0
3: 10
4: 131
Right 905390974 1:37635033-37635055 CGCTCTGCGCTCCGAGCGCGGGG 0: 1
1: 0
2: 1
3: 5
4: 67
905390969_905390979 4 Left 905390969 1:37635017-37635039 CCTTGCCCGAAGCTGGCGCTCTG 0: 1
1: 0
2: 0
3: 10
4: 131
Right 905390979 1:37635044-37635066 CCGAGCGCGGGGCTGGCGGAGGG 0: 1
1: 0
2: 2
3: 27
4: 212
905390969_905390976 0 Left 905390969 1:37635017-37635039 CCTTGCCCGAAGCTGGCGCTCTG 0: 1
1: 0
2: 0
3: 10
4: 131
Right 905390976 1:37635040-37635062 CGCTCCGAGCGCGGGGCTGGCGG 0: 1
1: 0
2: 2
3: 33
4: 197
905390969_905390980 17 Left 905390969 1:37635017-37635039 CCTTGCCCGAAGCTGGCGCTCTG 0: 1
1: 0
2: 0
3: 10
4: 131
Right 905390980 1:37635057-37635079 TGGCGGAGGGACAAGTCCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 112
905390969_905390977 3 Left 905390969 1:37635017-37635039 CCTTGCCCGAAGCTGGCGCTCTG 0: 1
1: 0
2: 0
3: 10
4: 131
Right 905390977 1:37635043-37635065 TCCGAGCGCGGGGCTGGCGGAGG 0: 1
1: 0
2: 2
3: 24
4: 254
905390969_905390973 -8 Left 905390969 1:37635017-37635039 CCTTGCCCGAAGCTGGCGCTCTG 0: 1
1: 0
2: 0
3: 10
4: 131
Right 905390973 1:37635032-37635054 GCGCTCTGCGCTCCGAGCGCGGG 0: 1
1: 0
2: 0
3: 4
4: 71
905390969_905390981 24 Left 905390969 1:37635017-37635039 CCTTGCCCGAAGCTGGCGCTCTG 0: 1
1: 0
2: 0
3: 10
4: 131
Right 905390981 1:37635064-37635086 GGGACAAGTCCCCAGGACCCTGG 0: 1
1: 0
2: 3
3: 21
4: 291
905390969_905390983 26 Left 905390969 1:37635017-37635039 CCTTGCCCGAAGCTGGCGCTCTG 0: 1
1: 0
2: 0
3: 10
4: 131
Right 905390983 1:37635066-37635088 GACAAGTCCCCAGGACCCTGGGG 0: 1
1: 0
2: 2
3: 20
4: 178
905390969_905390982 25 Left 905390969 1:37635017-37635039 CCTTGCCCGAAGCTGGCGCTCTG 0: 1
1: 0
2: 0
3: 10
4: 131
Right 905390982 1:37635065-37635087 GGACAAGTCCCCAGGACCCTGGG 0: 1
1: 1
2: 4
3: 22
4: 202
905390969_905390972 -9 Left 905390969 1:37635017-37635039 CCTTGCCCGAAGCTGGCGCTCTG 0: 1
1: 0
2: 0
3: 10
4: 131
Right 905390972 1:37635031-37635053 GGCGCTCTGCGCTCCGAGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905390969 Original CRISPR CAGAGCGCCAGCTTCGGGCA AGG (reversed) Intergenic