ID: 905390971

View in Genome Browser
Species Human (GRCh38)
Location 1:37635023-37635045
Sequence GGAGCGCAGAGCGCCAGCTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 99}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905390971_905390981 18 Left 905390971 1:37635023-37635045 CCGAAGCTGGCGCTCTGCGCTCC 0: 1
1: 0
2: 0
3: 6
4: 99
Right 905390981 1:37635064-37635086 GGGACAAGTCCCCAGGACCCTGG 0: 1
1: 0
2: 3
3: 21
4: 291
905390971_905390983 20 Left 905390971 1:37635023-37635045 CCGAAGCTGGCGCTCTGCGCTCC 0: 1
1: 0
2: 0
3: 6
4: 99
Right 905390983 1:37635066-37635088 GACAAGTCCCCAGGACCCTGGGG 0: 1
1: 0
2: 2
3: 20
4: 178
905390971_905390976 -6 Left 905390971 1:37635023-37635045 CCGAAGCTGGCGCTCTGCGCTCC 0: 1
1: 0
2: 0
3: 6
4: 99
Right 905390976 1:37635040-37635062 CGCTCCGAGCGCGGGGCTGGCGG 0: 1
1: 0
2: 2
3: 33
4: 197
905390971_905390977 -3 Left 905390971 1:37635023-37635045 CCGAAGCTGGCGCTCTGCGCTCC 0: 1
1: 0
2: 0
3: 6
4: 99
Right 905390977 1:37635043-37635065 TCCGAGCGCGGGGCTGGCGGAGG 0: 1
1: 0
2: 2
3: 24
4: 254
905390971_905390975 -9 Left 905390971 1:37635023-37635045 CCGAAGCTGGCGCTCTGCGCTCC 0: 1
1: 0
2: 0
3: 6
4: 99
Right 905390975 1:37635037-37635059 CTGCGCTCCGAGCGCGGGGCTGG 0: 1
1: 0
2: 1
3: 23
4: 171
905390971_905390979 -2 Left 905390971 1:37635023-37635045 CCGAAGCTGGCGCTCTGCGCTCC 0: 1
1: 0
2: 0
3: 6
4: 99
Right 905390979 1:37635044-37635066 CCGAGCGCGGGGCTGGCGGAGGG 0: 1
1: 0
2: 2
3: 27
4: 212
905390971_905390982 19 Left 905390971 1:37635023-37635045 CCGAAGCTGGCGCTCTGCGCTCC 0: 1
1: 0
2: 0
3: 6
4: 99
Right 905390982 1:37635065-37635087 GGACAAGTCCCCAGGACCCTGGG 0: 1
1: 1
2: 4
3: 22
4: 202
905390971_905390980 11 Left 905390971 1:37635023-37635045 CCGAAGCTGGCGCTCTGCGCTCC 0: 1
1: 0
2: 0
3: 6
4: 99
Right 905390980 1:37635057-37635079 TGGCGGAGGGACAAGTCCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905390971 Original CRISPR GGAGCGCAGAGCGCCAGCTT CGG (reversed) Intergenic