ID: 905390973

View in Genome Browser
Species Human (GRCh38)
Location 1:37635032-37635054
Sequence GCGCTCTGCGCTCCGAGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 71}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905390965_905390973 9 Left 905390965 1:37635000-37635022 CCCGGGAGTCCACACGTCCTTGC 0: 1
1: 0
2: 0
3: 6
4: 97
Right 905390973 1:37635032-37635054 GCGCTCTGCGCTCCGAGCGCGGG 0: 1
1: 0
2: 0
3: 4
4: 71
905390969_905390973 -8 Left 905390969 1:37635017-37635039 CCTTGCCCGAAGCTGGCGCTCTG 0: 1
1: 0
2: 0
3: 10
4: 131
Right 905390973 1:37635032-37635054 GCGCTCTGCGCTCCGAGCGCGGG 0: 1
1: 0
2: 0
3: 4
4: 71
905390966_905390973 8 Left 905390966 1:37635001-37635023 CCGGGAGTCCACACGTCCTTGCC 0: 1
1: 0
2: 0
3: 7
4: 108
Right 905390973 1:37635032-37635054 GCGCTCTGCGCTCCGAGCGCGGG 0: 1
1: 0
2: 0
3: 4
4: 71
905390964_905390973 13 Left 905390964 1:37634996-37635018 CCGGCCCGGGAGTCCACACGTCC 0: 1
1: 0
2: 0
3: 3
4: 108
Right 905390973 1:37635032-37635054 GCGCTCTGCGCTCCGAGCGCGGG 0: 1
1: 0
2: 0
3: 4
4: 71
905390967_905390973 0 Left 905390967 1:37635009-37635031 CCACACGTCCTTGCCCGAAGCTG 0: 1
1: 0
2: 0
3: 9
4: 71
Right 905390973 1:37635032-37635054 GCGCTCTGCGCTCCGAGCGCGGG 0: 1
1: 0
2: 0
3: 4
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905390973 Original CRISPR GCGCTCTGCGCTCCGAGCGC GGG Intergenic