ID: 905390977

View in Genome Browser
Species Human (GRCh38)
Location 1:37635043-37635065
Sequence TCCGAGCGCGGGGCTGGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 254}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905390965_905390977 20 Left 905390965 1:37635000-37635022 CCCGGGAGTCCACACGTCCTTGC 0: 1
1: 0
2: 0
3: 6
4: 97
Right 905390977 1:37635043-37635065 TCCGAGCGCGGGGCTGGCGGAGG 0: 1
1: 0
2: 2
3: 24
4: 254
905390971_905390977 -3 Left 905390971 1:37635023-37635045 CCGAAGCTGGCGCTCTGCGCTCC 0: 1
1: 0
2: 0
3: 6
4: 99
Right 905390977 1:37635043-37635065 TCCGAGCGCGGGGCTGGCGGAGG 0: 1
1: 0
2: 2
3: 24
4: 254
905390964_905390977 24 Left 905390964 1:37634996-37635018 CCGGCCCGGGAGTCCACACGTCC 0: 1
1: 0
2: 0
3: 3
4: 108
Right 905390977 1:37635043-37635065 TCCGAGCGCGGGGCTGGCGGAGG 0: 1
1: 0
2: 2
3: 24
4: 254
905390969_905390977 3 Left 905390969 1:37635017-37635039 CCTTGCCCGAAGCTGGCGCTCTG 0: 1
1: 0
2: 0
3: 10
4: 131
Right 905390977 1:37635043-37635065 TCCGAGCGCGGGGCTGGCGGAGG 0: 1
1: 0
2: 2
3: 24
4: 254
905390966_905390977 19 Left 905390966 1:37635001-37635023 CCGGGAGTCCACACGTCCTTGCC 0: 1
1: 0
2: 0
3: 7
4: 108
Right 905390977 1:37635043-37635065 TCCGAGCGCGGGGCTGGCGGAGG 0: 1
1: 0
2: 2
3: 24
4: 254
905390970_905390977 -2 Left 905390970 1:37635022-37635044 CCCGAAGCTGGCGCTCTGCGCTC 0: 1
1: 0
2: 0
3: 12
4: 105
Right 905390977 1:37635043-37635065 TCCGAGCGCGGGGCTGGCGGAGG 0: 1
1: 0
2: 2
3: 24
4: 254
905390967_905390977 11 Left 905390967 1:37635009-37635031 CCACACGTCCTTGCCCGAAGCTG 0: 1
1: 0
2: 0
3: 9
4: 71
Right 905390977 1:37635043-37635065 TCCGAGCGCGGGGCTGGCGGAGG 0: 1
1: 0
2: 2
3: 24
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905390977 Original CRISPR TCCGAGCGCGGGGCTGGCGG AGG Intergenic