ID: 905390977

View in Genome Browser
Species Human (GRCh38)
Location 1:37635043-37635065
Sequence TCCGAGCGCGGGGCTGGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 254}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905390966_905390977 19 Left 905390966 1:37635001-37635023 CCGGGAGTCCACACGTCCTTGCC 0: 1
1: 0
2: 0
3: 7
4: 108
Right 905390977 1:37635043-37635065 TCCGAGCGCGGGGCTGGCGGAGG 0: 1
1: 0
2: 2
3: 24
4: 254
905390967_905390977 11 Left 905390967 1:37635009-37635031 CCACACGTCCTTGCCCGAAGCTG 0: 1
1: 0
2: 0
3: 9
4: 71
Right 905390977 1:37635043-37635065 TCCGAGCGCGGGGCTGGCGGAGG 0: 1
1: 0
2: 2
3: 24
4: 254
905390964_905390977 24 Left 905390964 1:37634996-37635018 CCGGCCCGGGAGTCCACACGTCC 0: 1
1: 0
2: 0
3: 3
4: 108
Right 905390977 1:37635043-37635065 TCCGAGCGCGGGGCTGGCGGAGG 0: 1
1: 0
2: 2
3: 24
4: 254
905390971_905390977 -3 Left 905390971 1:37635023-37635045 CCGAAGCTGGCGCTCTGCGCTCC 0: 1
1: 0
2: 0
3: 6
4: 99
Right 905390977 1:37635043-37635065 TCCGAGCGCGGGGCTGGCGGAGG 0: 1
1: 0
2: 2
3: 24
4: 254
905390970_905390977 -2 Left 905390970 1:37635022-37635044 CCCGAAGCTGGCGCTCTGCGCTC 0: 1
1: 0
2: 0
3: 12
4: 105
Right 905390977 1:37635043-37635065 TCCGAGCGCGGGGCTGGCGGAGG 0: 1
1: 0
2: 2
3: 24
4: 254
905390965_905390977 20 Left 905390965 1:37635000-37635022 CCCGGGAGTCCACACGTCCTTGC 0: 1
1: 0
2: 0
3: 6
4: 97
Right 905390977 1:37635043-37635065 TCCGAGCGCGGGGCTGGCGGAGG 0: 1
1: 0
2: 2
3: 24
4: 254
905390969_905390977 3 Left 905390969 1:37635017-37635039 CCTTGCCCGAAGCTGGCGCTCTG 0: 1
1: 0
2: 0
3: 10
4: 131
Right 905390977 1:37635043-37635065 TCCGAGCGCGGGGCTGGCGGAGG 0: 1
1: 0
2: 2
3: 24
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905390977 Original CRISPR TCCGAGCGCGGGGCTGGCGG AGG Intergenic
900393467 1:2443694-2443716 TCCCGGCGCGGGGCGGGCAGGGG + Intronic
900479690 1:2891982-2892004 ACGGAGCGCGGGCCTGGCGGGGG + Intergenic
901059663 1:6466166-6466188 TGCGGGCGCGGGGCTGAAGGCGG - Exonic
901066595 1:6497338-6497360 GCCGCGCGGGGGGCGGGCGGCGG + Intronic
903907390 1:26696449-26696471 TCCGAGGGCGGCGGCGGCGGCGG - Exonic
905390977 1:37635043-37635065 TCCGAGCGCGGGGCTGGCGGAGG + Intergenic
905890541 1:41516110-41516132 GCCCAGCTCGGGGCTGGCCGGGG + Intronic
906306730 1:44724464-44724486 TCCGTGCGCCGGGTGGGCGGGGG + Intronic
906615837 1:47232253-47232275 GGCGGGCGCGGGGCGGGCGGGGG - Intergenic
910183067 1:84506289-84506311 CCCGAGCGCGAGCCTGGAGGAGG + Exonic
912818565 1:112849525-112849547 TCGGAGCGCGGCGCTAGTGGAGG - Intergenic
914702923 1:150150313-150150335 TCAGAGCGCGGAGGCGGCGGCGG - Intronic
917141645 1:171841501-171841523 GCCAAGCGGCGGGCTGGCGGCGG + Exonic
917817641 1:178725982-178726004 TCCGGGGCCGGGGCTGGCGGGGG - Intronic
919487225 1:198159202-198159224 TCCGAGCCCAGGGCTGGAGTAGG - Intronic
920022649 1:202967271-202967293 TCGGAGGGCGGGGCAGGCCGGGG + Exonic
920366464 1:205450604-205450626 TCCGAGCGCAGGACTGGGTGAGG - Intronic
920528608 1:206685654-206685676 GCCGAGTGCGGCGCGGGCGGCGG + Intronic
923055982 1:230426156-230426178 GCCGCGCGCGGGGCTGGCAGGGG + Intergenic
923591836 1:235327340-235327362 TCCGAGCGAGAGGCCGGCCGGGG + Intronic
1064443114 10:15371085-15371107 GCCGAGAGCGGGCCGGGCGGCGG + Intergenic
1065024211 10:21526072-21526094 TCCTCCCCCGGGGCTGGCGGCGG - Intergenic
1065342978 10:24723686-24723708 TCGGAGCGCGGCGGCGGCGGCGG - Intergenic
1072336514 10:94402911-94402933 TCCGATCGTGGGGCTGCCGAGGG - Exonic
1072970137 10:100010051-100010073 CGCGAGCGCGGGGCGGGCGCCGG - Intergenic
1073207396 10:101776220-101776242 GGGGAGCGCGGGGCGGGCGGCGG + Intronic
1074585895 10:114767917-114767939 CCCGGGCTCGGGGCTGCCGGGGG - Intergenic
1074591835 10:114821626-114821648 GCCTCGCGCGGGGCTGGAGGCGG - Intergenic
1074865697 10:117543328-117543350 TCGGAGCGCGAGGCGGGCAGGGG - Exonic
1075037350 10:119080524-119080546 TCCCCGCGCGGGCCGGGCGGCGG + Intronic
1075074711 10:119343035-119343057 TCCCAGTGTGGGGCTGGGGGAGG + Intronic
1075645442 10:124093261-124093283 TCCCGGCGCGGTGGTGGCGGTGG - Intronic
1076189221 10:128470888-128470910 TCAGAGCGCGGAGCTGGCACGGG + Intergenic
1077308792 11:1879490-1879512 TCTGTGAGCGGGGCTGGTGGTGG + Intronic
1077505743 11:2929370-2929392 GCCGAGCGCGGGACTGGGAGCGG + Exonic
1078377403 11:10808057-10808079 GCTGGGCGCCGGGCTGGCGGGGG - Intronic
1078771699 11:14358392-14358414 TCCGGGCGTGGGGCTGGAGCTGG - Intronic
1081861079 11:46333572-46333594 TCCCAGCGCCAGGCAGGCGGCGG - Intronic
1082162634 11:48901124-48901146 TCCGAGCCCTGAGCTGGCAGGGG - Intergenic
1083335129 11:61917612-61917634 TCCCAGCGCCGGGCCGGCGGAGG - Intronic
1083775991 11:64894532-64894554 TCTGAGAGGGGGGCTGGCGGTGG + Exonic
1084336606 11:68461202-68461224 ACCGGGCGCGGGCCGGGCGGGGG - Intronic
1084639210 11:70414459-70414481 TCCCAGAGCAGGGCTGGGGGAGG - Intronic
1084737332 11:71114006-71114028 GCCAAGCGGGGGGCTGGAGGAGG - Intronic
1089209457 11:116790557-116790579 GAGGCGCGCGGGGCTGGCGGGGG + Exonic
1089270867 11:117300449-117300471 TCCAAGCGGGGGGATGGGGGGGG + Intronic
1089647022 11:119887000-119887022 TCCATGCCCTGGGCTGGCGGCGG + Intergenic
1090699058 11:129278880-129278902 TCCGAACGCCCGGCTCGCGGAGG + Intronic
1090780353 11:130002127-130002149 GCCGGGCGCCGGGCTGGGGGTGG - Intronic
1090807217 11:130210084-130210106 GCCCAGCTTGGGGCTGGCGGGGG - Exonic
1094565030 12:31591172-31591194 TGGGAGCGCGGGGCGGGCGGGGG + Intergenic
1096241336 12:49961808-49961830 GCCGGGCGCGGGGCCGGCGCGGG - Intergenic
1096503576 12:52079872-52079894 GCCGCGCGCGGTGCAGGCGGTGG + Intergenic
1096660817 12:53122998-53123020 GCCGGGCGGGGGGCTGGAGGTGG + Intronic
1100423410 12:94459802-94459824 TCCGAGGGCGGCGGCGGCGGCGG + Exonic
1102101275 12:110281013-110281035 CGCGGTCGCGGGGCTGGCGGAGG - Intronic
1102973536 12:117190116-117190138 TCCGCGCGCGGGGCGGCCGCGGG + Intronic
1103032004 12:117623373-117623395 TCGGGGTGCGGGGCTGGGGGAGG - Intronic
1103441610 12:120967083-120967105 TTCGGTCGCGGGGCTGGCTGAGG - Intergenic
1104803473 12:131570283-131570305 TCTGAGCTCGGAGCTGGTGGAGG + Intergenic
1106304061 13:28494928-28494950 TCAGGGCGCGGGGCCGGCGGCGG - Exonic
1110219588 13:73059230-73059252 GCTCAGCGCGGGGCTGCCGGCGG - Exonic
1110318198 13:74134285-74134307 GCCGAGGGCGGGGGCGGCGGCGG + Intergenic
1111138802 13:84086666-84086688 TCCGAGTGCGGGGCCTGCCGAGG + Intergenic
1112503060 13:99956991-99957013 TCGGAGCGCCCGGCTGGCCGCGG + Intergenic
1113254917 13:108495955-108495977 TCCAAGCGCGGGGAACGCGGCGG + Intergenic
1113737649 13:112689930-112689952 TGTGGGCGCGGGGCCGGCGGGGG + Intergenic
1114736807 14:25050296-25050318 TCGGAGCGCGGAGGTGGCAGAGG + Exonic
1116817620 14:49598702-49598724 CCCGAGCGCGCAGCTGGCAGCGG - Exonic
1117092796 14:52267720-52267742 GCCGCGCGCGGAGCTGCCGGGGG + Exonic
1118339094 14:64879819-64879841 CCCGAGCCCGGGGGTGGCGGCGG + Exonic
1121423461 14:93832050-93832072 TCTGTGCGAGGGGATGGCGGGGG - Intergenic
1122470797 14:101964695-101964717 TCGGAGCCCGGGGGCGGCGGCGG + Exonic
1122768209 14:104085644-104085666 TGGGAGGGCGGGGCCGGCGGGGG - Intergenic
1122776178 14:104117858-104117880 TCCCAGCGAGGAACTGGCGGTGG + Intergenic
1122904553 14:104795770-104795792 TCCGGGCGCGGGGCGGGCGCGGG - Intergenic
1122978752 14:105181685-105181707 TCCGCGGGCGGGGCCGGGGGCGG + Intergenic
1123129249 14:105972341-105972363 TCCCAGGGCGGGGCAGGGGGTGG + Intergenic
1124484770 15:30104192-30104214 TCCTAGCGCGGGGCTGGCTTGGG + Intergenic
1124518812 15:30393046-30393068 TCCTAGCGCGGGGCTGGCTTGGG - Intronic
1124539844 15:30573200-30573222 TCCTAGCGCGGGGCTGGCTTGGG + Intergenic
1124758807 15:32434382-32434404 TCCTAGCGCGGGGCTGGCTTGGG - Intergenic
1125626897 15:41116181-41116203 TGCGGGCGCTGGGCCGGCGGCGG + Exonic
1129612346 15:77070855-77070877 GCAGAGCGAGGGGCCGGCGGCGG - Intronic
1130002646 15:80060167-80060189 TGCGAGCGGTTGGCTGGCGGGGG + Intronic
1131055326 15:89371504-89371526 TATGAGGGCGGGGCGGGCGGCGG - Intergenic
1132683445 16:1153016-1153038 GCCGGGGGCGGGGCGGGCGGGGG - Intergenic
1136871041 16:33808527-33808549 TCCCAGGGCGGGGCAGGGGGCGG - Intergenic
1137236239 16:46621002-46621024 TCCAACCTCGGGGCGGGCGGAGG + Intronic
1137767758 16:50991207-50991229 GCCGAGCGCCAGGCTGGCTGAGG + Intergenic
1139676949 16:68530293-68530315 TCCGCGCTCGGGGCTGGCGGCGG - Intronic
1140091937 16:71846020-71846042 TCCGGGGCCGGGGATGGCGGCGG + Exonic
1142240374 16:88941917-88941939 GGCGAGCGCGGGGCAGGGGGCGG - Intronic
1203101131 16_KI270728v1_random:1307531-1307553 TCCCAGGGCGGGGCAGGGGGCGG + Intergenic
1142591166 17:1006738-1006760 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591186 17:1006803-1006825 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591206 17:1006868-1006890 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591226 17:1006933-1006955 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591246 17:1006998-1007020 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591266 17:1007063-1007085 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591286 17:1007128-1007150 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1143527085 17:7479214-7479236 TCCGAGCGAGGGGCGGCCGTGGG - Intronic
1143747153 17:9003190-9003212 CCCGAGCGCGGGGCAGCCGCGGG - Intergenic
1145790284 17:27622350-27622372 GCCTAGTGCGGGGCGGGCGGAGG + Exonic
1146773125 17:35587390-35587412 GGCGAGGGCGGGGGTGGCGGCGG - Exonic
1147465522 17:40607810-40607832 TCGGAGCGGGGGGTTGGGGGAGG + Intergenic
1148124837 17:45231265-45231287 TCCCAGCGCTGGGCTGGGTGGGG + Intronic
1148225608 17:45896252-45896274 TCCGTGCGCGCTGCGGGCGGCGG + Intronic
1148419029 17:47530952-47530974 CGCGAGCGCAGGGCTGGAGGCGG - Intronic
1148603119 17:48908837-48908859 CCGGAGCTCGGGGCTGGGGGAGG - Intronic
1148880152 17:50719487-50719509 TCCGGGGGCGGGGCCCGCGGAGG - Intergenic
1149994578 17:61399987-61400009 TCTGTGCGCGGGGGCGGCGGGGG - Exonic
1151725045 17:75878654-75878676 GCCGAGCTGGGGGCGGGCGGGGG - Intergenic
1151819729 17:76490997-76491019 TGAGAGGGTGGGGCTGGCGGTGG + Intronic
1152077618 17:78168932-78168954 TCGGGGCGCGAGGCTGGGGGTGG - Intronic
1152227075 17:79097527-79097549 TCCGGGGGCGGGGCTTGGGGAGG - Intronic
1152349795 17:79778183-79778205 TCCGGGCGGGTGACTGGCGGCGG + Exonic
1152645282 17:81465794-81465816 TGGGAGCGGGGGGCTGGAGGCGG - Exonic
1153006274 18:500804-500826 GCCGAGGGCGGGGCGGGCGCGGG - Intergenic
1155146958 18:23092292-23092314 TGCGAACTCGGGGCTGGTGGAGG + Intergenic
1155209342 18:23586988-23587010 GCGGAGCGCGGGGTGGGCGGTGG + Intergenic
1155910349 18:31498188-31498210 TGCGCGCTCGGGGCAGGCGGCGG + Exonic
1156266330 18:35491420-35491442 TCCCAGCGGGGGTCTGGCAGAGG - Intronic
1156366080 18:36428538-36428560 TCTGAGGGTGGGGCTGGGGGCGG + Intronic
1160025061 18:75209649-75209671 CCCGAGCGCGGCCCGGGCGGCGG + Intergenic
1160826392 19:1082380-1082402 GACAAGTGCGGGGCTGGCGGTGG + Intronic
1160856838 19:1221581-1221603 CCCGAGGGTGGGGCTGGGGGAGG - Intronic
1160914743 19:1491127-1491149 TCCTAGCGGGGGGCCGGGGGCGG + Exonic
1160923045 19:1529506-1529528 TCCCAGCCCGGGGCTGCAGGTGG + Intronic
1161095002 19:2385155-2385177 GCGGAGGGCGGGGCTCGCGGGGG + Intergenic
1161366095 19:3880684-3880706 TCCCAGCTCAGGGCTGGCAGAGG - Exonic
1161473799 19:4473675-4473697 TCTGAGTGAGGGGCTGGGGGTGG + Intronic
1161702936 19:5804997-5805019 GCCGGGGGCGGGGCTGGGGGCGG - Intergenic
1162257039 19:9498830-9498852 CCCGGGGGCGGGGCTGGAGGTGG + Intergenic
1162412949 19:10517461-10517483 TCCGGGGGCGGGGCTGGAGCTGG + Intronic
1163118236 19:15200707-15200729 CCCAAGGCCGGGGCTGGCGGGGG - Intronic
1163243300 19:16077029-16077051 TCCGACTCCGGGGCTGGCGCCGG + Intronic
1163427155 19:17245932-17245954 TCCATTCGCGGGGCGGGCGGGGG + Exonic
1163695077 19:18759951-18759973 TCATGGGGCGGGGCTGGCGGCGG - Intronic
1163799762 19:19357228-19357250 TCAGAGGGCGGGGCTGGTGAGGG + Exonic
1167072956 19:47231157-47231179 TGCGAGCGGGCGCCTGGCGGCGG - Intronic
1167112783 19:47471815-47471837 CCCCAGCGCTGGGCTGGCAGTGG + Exonic
1167455692 19:49595909-49595931 GCTGAGCGAGGGGCTGGCTGTGG - Exonic
1167494515 19:49809666-49809688 CGCGAGCTCGGGGCTGGCTGTGG - Intronic
1167859240 19:52269878-52269900 ACGTGGCGCGGGGCTGGCGGAGG - Intronic
1167862542 19:52297128-52297150 TCCGAGCGGGGCGGGGGCGGGGG - Intergenic
1168291031 19:55357678-55357700 TCCGACCATGGGGCTGGTGGTGG - Intronic
1168683654 19:58335011-58335033 TCCGAGCGCTGTGCTGTCAGTGG + Exonic
927544425 2:23940384-23940406 GCCGAGGGCGGGGCTTGCCGCGG - Intronic
929588626 2:43131337-43131359 TCTGAGCCCGGGGCTGGCTCAGG + Intergenic
930781007 2:55224817-55224839 TCCGAGAACCGGGCTGGCTGGGG - Intronic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
935183026 2:100706929-100706951 TCCGAGCGCTGGGCAGGGGAGGG + Intergenic
935692634 2:105744928-105744950 GCCGAGCGGGCGGCGGGCGGAGG + Exonic
936279089 2:111122426-111122448 TCCGAGCGCTGCTCTGGCCGTGG - Intronic
937950838 2:127387344-127387366 GCCGGGAGGGGGGCTGGCGGCGG - Intronic
938054977 2:128208131-128208153 TCCGAGCCCGGGGCTGTGGCCGG - Intergenic
939612907 2:144332193-144332215 TCCGAGCGCGGTGCGGACGGCGG + Intronic
941843403 2:170110966-170110988 TCCAAGCGCAGGGCTGTCAGGGG - Intergenic
942034726 2:171999832-171999854 TGCGCGCGCGGGGCTGACTGCGG - Exonic
942678190 2:178450742-178450764 GCGGCGCGCGGGGCGGGCGGAGG - Intronic
944114289 2:196171099-196171121 TCCGCGCGGGGGGCGGCCGGCGG - Intronic
944645900 2:201780885-201780907 GCGGAGCGCGGTGCTGCCGGTGG - Exonic
946365072 2:219243998-219244020 TCCGAGGGTGGGGGTGGGGGTGG + Intronic
946875565 2:224126220-224126242 GCCGAGGGCGTGGCTGGCTGAGG + Intergenic
947623442 2:231604959-231604981 TCCTGGCCCGGGGCAGGCGGGGG + Intergenic
948645301 2:239400631-239400653 GCGGGGCGCGGGGCGGGCGGCGG + Exonic
948805926 2:240453438-240453460 TGCGGGAGCGGGGCGGGCGGAGG - Intronic
1169645367 20:7803805-7803827 TCCGAGCGCGGCGTTCGCGGAGG + Intergenic
1171209141 20:23303567-23303589 TCCCCCCGCGGGGCTGGCTGAGG + Intergenic
1171484462 20:25477125-25477147 CCCGAGAGAGGGGCTGGGGGCGG - Intronic
1172662039 20:36574425-36574447 TCTGGGCGCAGGGCTGGGGGGGG + Intronic
1173734313 20:45348492-45348514 TCCGGGCGGGGTGCGGGCGGCGG - Intergenic
1173930184 20:46811480-46811502 TGCGAGCGCGGCTCTGGTGGGGG - Intergenic
1176077344 20:63254472-63254494 GCCGAGCGCGGGGCACCCGGGGG - Exonic
1176124972 20:63471350-63471372 TCCTGGGGCAGGGCTGGCGGGGG - Intronic
1176242136 20:64080045-64080067 GCCGAGCGCGGGGCGGGGCGCGG - Intergenic
1176274487 20:64255961-64255983 TCCGGGCGCAGGGGTGCCGGGGG - Intronic
1176303838 21:5113366-5113388 TCAGAGCCCGGGCCTGGCCGGGG + Intergenic
1179209530 21:39313493-39313515 GCCGGGCGCGGGGCGGGAGGCGG + Exonic
1179853192 21:44148584-44148606 TCAGAGCCCGGGCCTGGCCGGGG - Intergenic
1180162745 21:46005645-46005667 GCCGAGGGCTGGGCTGGAGGAGG + Intergenic
1180707464 22:17818258-17818280 TCCTCGCCCGGGGGTGGCGGTGG + Exonic
1180831093 22:18906486-18906508 TACGCGGGCGGGGCGGGCGGCGG + Intronic
1180908368 22:19431583-19431605 TGAGGGCGCGGGGCGGGCGGCGG - Exonic
1180959239 22:19755249-19755271 ACCGCGGGCGGGGGTGGCGGGGG - Intergenic
1181283532 22:21736166-21736188 TCGGCCGGCGGGGCTGGCGGTGG + Intergenic
1182445506 22:30387284-30387306 TCTCAGCGCGGGGCGAGCGGCGG + Exonic
1183071750 22:35400960-35400982 TCCGGGCGTGGTGATGGCGGGGG - Intronic
1183649445 22:39145655-39145677 TGCGTGCGCGCGGCCGGCGGGGG - Intronic
1184361975 22:44024315-44024337 GCCGCGCGTGGGGCCGGCGGCGG - Intronic
1184681130 22:46072542-46072564 CGCGAGCGCGGCGCCGGCGGCGG + Intronic
1184710174 22:46245097-46245119 TCCGAGAACCGGGCTGGCTGGGG + Exonic
1184747588 22:46465203-46465225 TCTGAGCCCGGGCCTGGAGGTGG - Intronic
1185055441 22:48576347-48576369 GCGGAGCGCGGCGTTGGCGGCGG + Intronic
1203281180 22_KI270734v1_random:131757-131779 TACGCGGGCGGGGCGGGCGGCGG + Intergenic
950232680 3:11290335-11290357 TCCCAGCGCGGTGATGGAGGAGG + Intronic
950282501 3:11719795-11719817 ACCGGGCGCGCAGCTGGCGGGGG - Intronic
950454126 3:13082664-13082686 TCCCAGTGCGGGGCTAGGGGTGG - Intergenic
950940042 3:16883894-16883916 TCCGTGCGCGGGGCTGGGGCAGG + Intronic
951719804 3:25686867-25686889 TCCGGGTCCGGTGCTGGCGGCGG - Intergenic
953705285 3:45226045-45226067 TACGCGCGCGAGGCCGGCGGCGG + Exonic
953908924 3:46882295-46882317 TCCGAGCGGCGGCCGGGCGGGGG + Intronic
953947770 3:47164006-47164028 TCCGACCGCGGCGGCGGCGGCGG + Intergenic
954375965 3:50194288-50194310 ACCGCGCGCTGGGCTGGGGGAGG + Intronic
954397334 3:50299657-50299679 GCCTGGGGCGGGGCTGGCGGAGG - Intergenic
967926601 3:194653782-194653804 TCCCAGCGCTTGGGTGGCGGAGG + Intronic
968043841 3:195612435-195612457 TGCGGGGGCGGGGCTGGAGGAGG + Intergenic
968136038 3:196220153-196220175 GCTGCGCGCCGGGCTGGCGGAGG + Intronic
968161655 3:196432062-196432084 TCCCAGGTCTGGGCTGGCGGGGG + Intronic
968912554 4:3483528-3483550 TGGGAGCCCGAGGCTGGCGGTGG + Intronic
969659449 4:8517977-8517999 TCTGAGTGAGGGGCTGGAGGTGG - Intergenic
977536531 4:98261297-98261319 TCCGAGCGGGCGGGCGGCGGAGG - Intergenic
983537863 4:168877790-168877812 GCGCTGCGCGGGGCTGGCGGAGG - Intronic
984781937 4:183533933-183533955 TCCGAGGCCGGGGCAGGGGGAGG + Intergenic
987415390 5:17656239-17656261 TCCGGGAGCGGGGTGGGCGGGGG + Intergenic
989599963 5:43192134-43192156 CCGGAGCGAGGGGCTGGCGTGGG - Intronic
991587493 5:68215600-68215622 TCCGAGCCGGCGGCTGGCAGTGG - Intergenic
992069089 5:73133473-73133495 TCCTAGCACGGTGCTGGCAGAGG + Intergenic
994670246 5:102755099-102755121 GGCGAGCGCGGGGCTGGCCCGGG + Intronic
996404175 5:123090171-123090193 TCCGGGGGCGGGGGCGGCGGCGG - Exonic
997326480 5:133026179-133026201 TCCACGCGTGGGGTTGGCGGAGG + Intronic
1002296149 5:178232466-178232488 CCCGGGCGGGGGGCGGGCGGCGG - Intronic
1002645211 5:180649440-180649462 CCCGAGCGTGGGGCTGGCCGGGG - Intronic
1003107782 6:3228598-3228620 CCCGGGGGCGGGGCTGTCGGCGG + Intronic
1003111343 6:3253967-3253989 TCCGCCCGTGGCGCTGGCGGGGG + Intronic
1004396121 6:15248122-15248144 TGCAAGCCCGTGGCTGGCGGCGG + Intronic
1005114297 6:22318693-22318715 TCTGAGTGCGGGGCTTGCCGAGG + Intergenic
1005847519 6:29792910-29792932 TCGGTGGGCGGGGCTGGCCGCGG + Intergenic
1007666542 6:43516835-43516857 TCCGCGCGCGGGGCTAGCGCGGG - Exonic
1008545174 6:52577268-52577290 GCCGGGCGCGGCGCTGGCGCGGG - Intergenic
1009835199 6:68991547-68991569 TGGGAGCGAGGGGATGGCGGGGG - Intronic
1010703233 6:79077566-79077588 CCGGGGCGCGGGGCGGGCGGGGG - Intronic
1010794837 6:80106771-80106793 TCCTGGCGCGGGGCTGGCGCGGG + Exonic
1011128947 6:84034500-84034522 ACGGGGCGCGGGGCGGGCGGGGG - Intronic
1012399864 6:98834403-98834425 TCCGAGCCCGGGGGAGGGGGAGG + Intergenic
1012624760 6:101392687-101392709 TTCCAGGGAGGGGCTGGCGGCGG - Intergenic
1016400858 6:143678244-143678266 CGCGGGCGCAGGGCTGGCGGCGG + Intronic
1019343004 7:517352-517374 TCCGCGCGCGGGGAGGGCGCGGG - Intronic
1019343584 7:519517-519539 GGCGAGCGCGGGGCCGGCGGTGG - Intronic
1019562632 7:1666079-1666101 CCCGAGCGCGGCGGCGGCGGCGG - Intergenic
1021452817 7:20798186-20798208 GCAGAGCACGGAGCTGGCGGCGG - Intergenic
1021868682 7:24981881-24981903 TCCGACGGCGGGGCTGGGCGTGG - Intergenic
1022207889 7:28180612-28180634 TGCGAGCGCCGGGCGGGCGAGGG + Exonic
1027374399 7:77536704-77536726 TCCCAGCCCACGGCTGGCGGCGG + Intergenic
1029372491 7:100158427-100158449 GCCGCGCGCGGAGCTGGCAGGGG - Exonic
1031051947 7:116953765-116953787 CCCGAGCGCGCGCCTGGCCGCGG - Intronic
1031369799 7:120950926-120950948 TGAGTGCGCGGCGCTGGCGGCGG + Intronic
1033120736 7:138664800-138664822 GTCGAGCGCCGGGGTGGCGGAGG - Intronic
1033120774 7:138664899-138664921 GTCGAGCGCGGGGCTGGTTGGGG - Intronic
1034418818 7:150978471-150978493 GCAGAGCGAGGGGCTGGCGTTGG - Intergenic
1035670349 8:1412231-1412253 TCAGAGCAGGAGGCTGGCGGGGG - Intergenic
1038319414 8:26513886-26513908 CCGGAGCGCGGGGCTAGGGGCGG + Exonic
1038828508 8:31033024-31033046 GCGGAGCGCGGGACGGGCGGCGG - Exonic
1040694459 8:49979284-49979306 TCGTGGCGCGGGGCAGGCGGCGG - Intronic
1042591687 8:70403359-70403381 CCGGAGCGCGAGGCGGGCGGAGG - Intronic
1043148294 8:76682327-76682349 TTAGTGTGCGGGGCTGGCGGAGG + Intronic
1047420334 8:124702722-124702744 TCAGAGAGCGGGGCAGGCAGGGG - Intronic
1049166417 8:141128672-141128694 CCCGAGTGCGGTACTGGCGGCGG + Exonic
1049756238 8:144312366-144312388 TCGGAGCTCGGGGCTGGGGAGGG + Intronic
1049761522 8:144333954-144333976 TCCGGGCGCGGGGTGGGCGGCGG + Exonic
1055945751 9:81689614-81689636 CGCGAGCGCGGAGCCGGCGGGGG + Intergenic
1057596446 9:96418871-96418893 ACCGAGGGCGGGGCGGGCGGCGG - Intergenic
1059375402 9:113876647-113876669 TCCGAGCCCGGGGCCGGAGGGGG - Intronic
1059967912 9:119634204-119634226 TCTGATGGCGGGGCTGGCAGAGG + Intergenic
1060974304 9:127755369-127755391 TGGGAGCGGGGGGCGGGCGGAGG - Intronic
1061084921 9:128393118-128393140 TGCGTGCGCGGGGCTGGGCGGGG - Intergenic
1061135329 9:128730307-128730329 TCCGAGTGCTGGTCTGGAGGCGG + Exonic
1061382316 9:130265856-130265878 GCCGAGCGCGGCTCTGGCTGCGG - Intergenic
1062349899 9:136133457-136133479 TCCGGGCGCGGGGCTGGGGGCGG - Intergenic
1062461953 9:136665919-136665941 GCCGCGCGCGGAGCTGGGGGCGG + Intronic
1062537774 9:137028376-137028398 CCCGGGCGCGGCGCGGGCGGCGG - Intronic
1062624401 9:137436349-137436371 TATGGGCGCGGGGCTGGCGTGGG - Intronic
1062624419 9:137436401-137436423 TATGGGCGCGGGGCTGGCGTGGG - Intronic
1187752200 X:22478889-22478911 TCCTAGCGTGGGGCTTGCTGAGG + Intergenic
1189281290 X:39821468-39821490 TGGGAGCGCGGGGGTGGGGGAGG + Intergenic
1189461085 X:41243531-41243553 GCCGAGCGGGGGGCGGGGGGGGG + Intergenic
1193732003 X:85113013-85113035 TGACAGCGCGGGGCTGGTGGTGG + Intergenic
1197712808 X:129684073-129684095 TCCGAGCCTCGGGCTGGTGGAGG - Intergenic
1200217533 X:154374679-154374701 GCCGGGCGCGGGGCGGGCGCGGG - Intergenic
1200309448 X:155062754-155062776 ACCAAGGGCGGGGTTGGCGGGGG + Intronic