ID: 905394997

View in Genome Browser
Species Human (GRCh38)
Location 1:37661215-37661237
Sequence GCCAATGCTGGCCCTCAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905394997_905395003 22 Left 905394997 1:37661215-37661237 CCTCCTTGAGGGCCAGCATTGGC No data
Right 905395003 1:37661260-37661282 AGCATCCTTCAGTCCGGCCCCGG No data
905394997_905395002 16 Left 905394997 1:37661215-37661237 CCTCCTTGAGGGCCAGCATTGGC No data
Right 905395002 1:37661254-37661276 AGTCATAGCATCCTTCAGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905394997 Original CRISPR GCCAATGCTGGCCCTCAAGG AGG (reversed) Intergenic