ID: 905394997 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:37661215-37661237 |
| Sequence | GCCAATGCTGGCCCTCAAGG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 905394997_905395003 | 22 | Left | 905394997 | 1:37661215-37661237 | CCTCCTTGAGGGCCAGCATTGGC | No data | ||
| Right | 905395003 | 1:37661260-37661282 | AGCATCCTTCAGTCCGGCCCCGG | No data | ||||
| 905394997_905395002 | 16 | Left | 905394997 | 1:37661215-37661237 | CCTCCTTGAGGGCCAGCATTGGC | No data | ||
| Right | 905395002 | 1:37661254-37661276 | AGTCATAGCATCCTTCAGTCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 905394997 | Original CRISPR | GCCAATGCTGGCCCTCAAGG AGG (reversed) | Intergenic | ||