ID: 905397173

View in Genome Browser
Species Human (GRCh38)
Location 1:37674218-37674240
Sequence CTTTCCCAGACCGCCTGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905397173_905397179 7 Left 905397173 1:37674218-37674240 CCAAGCCAGGCGGTCTGGGAAAG No data
Right 905397179 1:37674248-37674270 GCTCTGCCCAGCCTGGCCTGTGG No data
905397173_905397185 22 Left 905397173 1:37674218-37674240 CCAAGCCAGGCGGTCTGGGAAAG No data
Right 905397185 1:37674263-37674285 GCCTGTGGGTCTTTGCTGCTGGG No data
905397173_905397188 27 Left 905397173 1:37674218-37674240 CCAAGCCAGGCGGTCTGGGAAAG No data
Right 905397188 1:37674268-37674290 TGGGTCTTTGCTGCTGGGATGGG No data
905397173_905397178 0 Left 905397173 1:37674218-37674240 CCAAGCCAGGCGGTCTGGGAAAG No data
Right 905397178 1:37674241-37674263 GGAGGATGCTCTGCCCAGCCTGG No data
905397173_905397187 26 Left 905397173 1:37674218-37674240 CCAAGCCAGGCGGTCTGGGAAAG No data
Right 905397187 1:37674267-37674289 GTGGGTCTTTGCTGCTGGGATGG No data
905397173_905397184 21 Left 905397173 1:37674218-37674240 CCAAGCCAGGCGGTCTGGGAAAG No data
Right 905397184 1:37674262-37674284 GGCCTGTGGGTCTTTGCTGCTGG No data
905397173_905397189 28 Left 905397173 1:37674218-37674240 CCAAGCCAGGCGGTCTGGGAAAG No data
Right 905397189 1:37674269-37674291 GGGTCTTTGCTGCTGGGATGGGG No data
905397173_905397180 8 Left 905397173 1:37674218-37674240 CCAAGCCAGGCGGTCTGGGAAAG No data
Right 905397180 1:37674249-37674271 CTCTGCCCAGCCTGGCCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905397173 Original CRISPR CTTTCCCAGACCGCCTGGCT TGG (reversed) Intergenic