ID: 905397257

View in Genome Browser
Species Human (GRCh38)
Location 1:37674708-37674730
Sequence GTGGGCTCTGCTCTACCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905397257_905397267 29 Left 905397257 1:37674708-37674730 CCACTGGGTAGAGCAGAGCCCAC No data
Right 905397267 1:37674760-37674782 CCTGCACCATTTCTACCACTTGG No data
905397257_905397261 4 Left 905397257 1:37674708-37674730 CCACTGGGTAGAGCAGAGCCCAC No data
Right 905397261 1:37674735-37674757 TCCACGCCATGCAGCTGCAAAGG No data
905397257_905397268 30 Left 905397257 1:37674708-37674730 CCACTGGGTAGAGCAGAGCCCAC No data
Right 905397268 1:37674761-37674783 CTGCACCATTTCTACCACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905397257 Original CRISPR GTGGGCTCTGCTCTACCCAG TGG (reversed) Intergenic