ID: 905397258

View in Genome Browser
Species Human (GRCh38)
Location 1:37674726-37674748
Sequence CTGCATGGCGTGGAGAAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905397258_905397271 27 Left 905397258 1:37674726-37674748 CCCACCTTCTCCACGCCATGCAG No data
Right 905397271 1:37674776-37674798 CACTTGGGTCAATTCCCAAATGG No data
905397258_905397272 28 Left 905397258 1:37674726-37674748 CCCACCTTCTCCACGCCATGCAG No data
Right 905397272 1:37674777-37674799 ACTTGGGTCAATTCCCAAATGGG No data
905397258_905397267 11 Left 905397258 1:37674726-37674748 CCCACCTTCTCCACGCCATGCAG No data
Right 905397267 1:37674760-37674782 CCTGCACCATTTCTACCACTTGG No data
905397258_905397273 29 Left 905397258 1:37674726-37674748 CCCACCTTCTCCACGCCATGCAG No data
Right 905397273 1:37674778-37674800 CTTGGGTCAATTCCCAAATGGGG No data
905397258_905397268 12 Left 905397258 1:37674726-37674748 CCCACCTTCTCCACGCCATGCAG No data
Right 905397268 1:37674761-37674783 CTGCACCATTTCTACCACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905397258 Original CRISPR CTGCATGGCGTGGAGAAGGT GGG (reversed) Intergenic