ID: 905397259

View in Genome Browser
Species Human (GRCh38)
Location 1:37674727-37674749
Sequence GCTGCATGGCGTGGAGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 300}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905397259_905397272 27 Left 905397259 1:37674727-37674749 CCACCTTCTCCACGCCATGCAGC 0: 1
1: 0
2: 1
3: 22
4: 300
Right 905397272 1:37674777-37674799 ACTTGGGTCAATTCCCAAATGGG No data
905397259_905397268 11 Left 905397259 1:37674727-37674749 CCACCTTCTCCACGCCATGCAGC 0: 1
1: 0
2: 1
3: 22
4: 300
Right 905397268 1:37674761-37674783 CTGCACCATTTCTACCACTTGGG No data
905397259_905397267 10 Left 905397259 1:37674727-37674749 CCACCTTCTCCACGCCATGCAGC 0: 1
1: 0
2: 1
3: 22
4: 300
Right 905397267 1:37674760-37674782 CCTGCACCATTTCTACCACTTGG No data
905397259_905397273 28 Left 905397259 1:37674727-37674749 CCACCTTCTCCACGCCATGCAGC 0: 1
1: 0
2: 1
3: 22
4: 300
Right 905397273 1:37674778-37674800 CTTGGGTCAATTCCCAAATGGGG No data
905397259_905397271 26 Left 905397259 1:37674727-37674749 CCACCTTCTCCACGCCATGCAGC 0: 1
1: 0
2: 1
3: 22
4: 300
Right 905397271 1:37674776-37674798 CACTTGGGTCAATTCCCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905397259 Original CRISPR GCTGCATGGCGTGGAGAAGG TGG (reversed) Intergenic