ID: 905397260

View in Genome Browser
Species Human (GRCh38)
Location 1:37674730-37674752
Sequence GCAGCTGCATGGCGTGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905397260_905397267 7 Left 905397260 1:37674730-37674752 CCTTCTCCACGCCATGCAGCTGC No data
Right 905397267 1:37674760-37674782 CCTGCACCATTTCTACCACTTGG No data
905397260_905397272 24 Left 905397260 1:37674730-37674752 CCTTCTCCACGCCATGCAGCTGC No data
Right 905397272 1:37674777-37674799 ACTTGGGTCAATTCCCAAATGGG No data
905397260_905397273 25 Left 905397260 1:37674730-37674752 CCTTCTCCACGCCATGCAGCTGC No data
Right 905397273 1:37674778-37674800 CTTGGGTCAATTCCCAAATGGGG No data
905397260_905397268 8 Left 905397260 1:37674730-37674752 CCTTCTCCACGCCATGCAGCTGC No data
Right 905397268 1:37674761-37674783 CTGCACCATTTCTACCACTTGGG No data
905397260_905397271 23 Left 905397260 1:37674730-37674752 CCTTCTCCACGCCATGCAGCTGC No data
Right 905397271 1:37674776-37674798 CACTTGGGTCAATTCCCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905397260 Original CRISPR GCAGCTGCATGGCGTGGAGA AGG (reversed) Intergenic