ID: 905397263

View in Genome Browser
Species Human (GRCh38)
Location 1:37674741-37674763
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905397263_905397271 12 Left 905397263 1:37674741-37674763 CCATGCAGCTGCAAAGGCCCCTG No data
Right 905397271 1:37674776-37674798 CACTTGGGTCAATTCCCAAATGG No data
905397263_905397267 -4 Left 905397263 1:37674741-37674763 CCATGCAGCTGCAAAGGCCCCTG No data
Right 905397267 1:37674760-37674782 CCTGCACCATTTCTACCACTTGG No data
905397263_905397268 -3 Left 905397263 1:37674741-37674763 CCATGCAGCTGCAAAGGCCCCTG No data
Right 905397268 1:37674761-37674783 CTGCACCATTTCTACCACTTGGG No data
905397263_905397273 14 Left 905397263 1:37674741-37674763 CCATGCAGCTGCAAAGGCCCCTG No data
Right 905397273 1:37674778-37674800 CTTGGGTCAATTCCCAAATGGGG No data
905397263_905397272 13 Left 905397263 1:37674741-37674763 CCATGCAGCTGCAAAGGCCCCTG No data
Right 905397272 1:37674777-37674799 ACTTGGGTCAATTCCCAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905397263 Original CRISPR CAGGGGCCTTTGCAGCTGCA TGG (reversed) Intergenic