ID: 905397264

View in Genome Browser
Species Human (GRCh38)
Location 1:37674758-37674780
Sequence AAGTGGTAGAAATGGTGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905397264_905397277 22 Left 905397264 1:37674758-37674780 CCCCTGCACCATTTCTACCACTT No data
Right 905397277 1:37674803-37674825 GAGCCCCTTGCTGAGCTGGTAGG No data
905397264_905397272 -4 Left 905397264 1:37674758-37674780 CCCCTGCACCATTTCTACCACTT No data
Right 905397272 1:37674777-37674799 ACTTGGGTCAATTCCCAAATGGG No data
905397264_905397278 23 Left 905397264 1:37674758-37674780 CCCCTGCACCATTTCTACCACTT No data
Right 905397278 1:37674804-37674826 AGCCCCTTGCTGAGCTGGTAGGG No data
905397264_905397276 18 Left 905397264 1:37674758-37674780 CCCCTGCACCATTTCTACCACTT No data
Right 905397276 1:37674799-37674821 GGCTGAGCCCCTTGCTGAGCTGG No data
905397264_905397273 -3 Left 905397264 1:37674758-37674780 CCCCTGCACCATTTCTACCACTT No data
Right 905397273 1:37674778-37674800 CTTGGGTCAATTCCCAAATGGGG No data
905397264_905397271 -5 Left 905397264 1:37674758-37674780 CCCCTGCACCATTTCTACCACTT No data
Right 905397271 1:37674776-37674798 CACTTGGGTCAATTCCCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905397264 Original CRISPR AAGTGGTAGAAATGGTGCAG GGG (reversed) Intergenic
No off target data available for this crispr