ID: 905397266

View in Genome Browser
Species Human (GRCh38)
Location 1:37674760-37674782
Sequence CCAAGTGGTAGAAATGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905397266_905397271 -7 Left 905397266 1:37674760-37674782 CCTGCACCATTTCTACCACTTGG No data
Right 905397271 1:37674776-37674798 CACTTGGGTCAATTCCCAAATGG No data
905397266_905397277 20 Left 905397266 1:37674760-37674782 CCTGCACCATTTCTACCACTTGG No data
Right 905397277 1:37674803-37674825 GAGCCCCTTGCTGAGCTGGTAGG No data
905397266_905397278 21 Left 905397266 1:37674760-37674782 CCTGCACCATTTCTACCACTTGG No data
Right 905397278 1:37674804-37674826 AGCCCCTTGCTGAGCTGGTAGGG No data
905397266_905397272 -6 Left 905397266 1:37674760-37674782 CCTGCACCATTTCTACCACTTGG No data
Right 905397272 1:37674777-37674799 ACTTGGGTCAATTCCCAAATGGG No data
905397266_905397276 16 Left 905397266 1:37674760-37674782 CCTGCACCATTTCTACCACTTGG No data
Right 905397276 1:37674799-37674821 GGCTGAGCCCCTTGCTGAGCTGG No data
905397266_905397273 -5 Left 905397266 1:37674760-37674782 CCTGCACCATTTCTACCACTTGG No data
Right 905397273 1:37674778-37674800 CTTGGGTCAATTCCCAAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905397266 Original CRISPR CCAAGTGGTAGAAATGGTGC AGG (reversed) Intergenic