ID: 905397268

View in Genome Browser
Species Human (GRCh38)
Location 1:37674761-37674783
Sequence CTGCACCATTTCTACCACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905397263_905397268 -3 Left 905397263 1:37674741-37674763 CCATGCAGCTGCAAAGGCCCCTG No data
Right 905397268 1:37674761-37674783 CTGCACCATTTCTACCACTTGGG No data
905397258_905397268 12 Left 905397258 1:37674726-37674748 CCCACCTTCTCCACGCCATGCAG No data
Right 905397268 1:37674761-37674783 CTGCACCATTTCTACCACTTGGG No data
905397260_905397268 8 Left 905397260 1:37674730-37674752 CCTTCTCCACGCCATGCAGCTGC No data
Right 905397268 1:37674761-37674783 CTGCACCATTTCTACCACTTGGG No data
905397259_905397268 11 Left 905397259 1:37674727-37674749 CCACCTTCTCCACGCCATGCAGC No data
Right 905397268 1:37674761-37674783 CTGCACCATTTCTACCACTTGGG No data
905397257_905397268 30 Left 905397257 1:37674708-37674730 CCACTGGGTAGAGCAGAGCCCAC No data
Right 905397268 1:37674761-37674783 CTGCACCATTTCTACCACTTGGG No data
905397262_905397268 2 Left 905397262 1:37674736-37674758 CCACGCCATGCAGCTGCAAAGGC No data
Right 905397268 1:37674761-37674783 CTGCACCATTTCTACCACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905397268 Original CRISPR CTGCACCATTTCTACCACTT GGG Intergenic