ID: 905397269

View in Genome Browser
Species Human (GRCh38)
Location 1:37674766-37674788
Sequence ATTGACCCAAGTGGTAGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905397269_905397278 15 Left 905397269 1:37674766-37674788 CCATTTCTACCACTTGGGTCAAT No data
Right 905397278 1:37674804-37674826 AGCCCCTTGCTGAGCTGGTAGGG No data
905397269_905397282 27 Left 905397269 1:37674766-37674788 CCATTTCTACCACTTGGGTCAAT No data
Right 905397282 1:37674816-37674838 AGCTGGTAGGGATATAAGAATGG No data
905397269_905397277 14 Left 905397269 1:37674766-37674788 CCATTTCTACCACTTGGGTCAAT No data
Right 905397277 1:37674803-37674825 GAGCCCCTTGCTGAGCTGGTAGG No data
905397269_905397276 10 Left 905397269 1:37674766-37674788 CCATTTCTACCACTTGGGTCAAT No data
Right 905397276 1:37674799-37674821 GGCTGAGCCCCTTGCTGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905397269 Original CRISPR ATTGACCCAAGTGGTAGAAA TGG (reversed) Intergenic
No off target data available for this crispr