ID: 905397272

View in Genome Browser
Species Human (GRCh38)
Location 1:37674777-37674799
Sequence ACTTGGGTCAATTCCCAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905397262_905397272 18 Left 905397262 1:37674736-37674758 CCACGCCATGCAGCTGCAAAGGC No data
Right 905397272 1:37674777-37674799 ACTTGGGTCAATTCCCAAATGGG No data
905397259_905397272 27 Left 905397259 1:37674727-37674749 CCACCTTCTCCACGCCATGCAGC No data
Right 905397272 1:37674777-37674799 ACTTGGGTCAATTCCCAAATGGG No data
905397265_905397272 -5 Left 905397265 1:37674759-37674781 CCCTGCACCATTTCTACCACTTG No data
Right 905397272 1:37674777-37674799 ACTTGGGTCAATTCCCAAATGGG No data
905397263_905397272 13 Left 905397263 1:37674741-37674763 CCATGCAGCTGCAAAGGCCCCTG No data
Right 905397272 1:37674777-37674799 ACTTGGGTCAATTCCCAAATGGG No data
905397266_905397272 -6 Left 905397266 1:37674760-37674782 CCTGCACCATTTCTACCACTTGG No data
Right 905397272 1:37674777-37674799 ACTTGGGTCAATTCCCAAATGGG No data
905397260_905397272 24 Left 905397260 1:37674730-37674752 CCTTCTCCACGCCATGCAGCTGC No data
Right 905397272 1:37674777-37674799 ACTTGGGTCAATTCCCAAATGGG No data
905397258_905397272 28 Left 905397258 1:37674726-37674748 CCCACCTTCTCCACGCCATGCAG No data
Right 905397272 1:37674777-37674799 ACTTGGGTCAATTCCCAAATGGG No data
905397264_905397272 -4 Left 905397264 1:37674758-37674780 CCCCTGCACCATTTCTACCACTT No data
Right 905397272 1:37674777-37674799 ACTTGGGTCAATTCCCAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905397272 Original CRISPR ACTTGGGTCAATTCCCAAAT GGG Intergenic