ID: 905397273

View in Genome Browser
Species Human (GRCh38)
Location 1:37674778-37674800
Sequence CTTGGGTCAATTCCCAAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905397265_905397273 -4 Left 905397265 1:37674759-37674781 CCCTGCACCATTTCTACCACTTG No data
Right 905397273 1:37674778-37674800 CTTGGGTCAATTCCCAAATGGGG No data
905397266_905397273 -5 Left 905397266 1:37674760-37674782 CCTGCACCATTTCTACCACTTGG 0: 1
1: 0
2: 1
3: 16
4: 193
Right 905397273 1:37674778-37674800 CTTGGGTCAATTCCCAAATGGGG No data
905397258_905397273 29 Left 905397258 1:37674726-37674748 CCCACCTTCTCCACGCCATGCAG 0: 1
1: 0
2: 2
3: 15
4: 182
Right 905397273 1:37674778-37674800 CTTGGGTCAATTCCCAAATGGGG No data
905397264_905397273 -3 Left 905397264 1:37674758-37674780 CCCCTGCACCATTTCTACCACTT No data
Right 905397273 1:37674778-37674800 CTTGGGTCAATTCCCAAATGGGG No data
905397259_905397273 28 Left 905397259 1:37674727-37674749 CCACCTTCTCCACGCCATGCAGC 0: 1
1: 0
2: 1
3: 22
4: 300
Right 905397273 1:37674778-37674800 CTTGGGTCAATTCCCAAATGGGG No data
905397263_905397273 14 Left 905397263 1:37674741-37674763 CCATGCAGCTGCAAAGGCCCCTG No data
Right 905397273 1:37674778-37674800 CTTGGGTCAATTCCCAAATGGGG No data
905397260_905397273 25 Left 905397260 1:37674730-37674752 CCTTCTCCACGCCATGCAGCTGC 0: 1
1: 1
2: 2
3: 20
4: 305
Right 905397273 1:37674778-37674800 CTTGGGTCAATTCCCAAATGGGG No data
905397262_905397273 19 Left 905397262 1:37674736-37674758 CCACGCCATGCAGCTGCAAAGGC No data
Right 905397273 1:37674778-37674800 CTTGGGTCAATTCCCAAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905397273 Original CRISPR CTTGGGTCAATTCCCAAATG GGG Intergenic