ID: 905397274

View in Genome Browser
Species Human (GRCh38)
Location 1:37674790-37674812
Sequence CAAGGGGCTCAGCCCCATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905397274_905397283 29 Left 905397274 1:37674790-37674812 CCCAAATGGGGCTGAGCCCCTTG No data
Right 905397283 1:37674842-37674864 AGAAAAAAATAAAATCCTGCAGG No data
905397274_905397277 -10 Left 905397274 1:37674790-37674812 CCCAAATGGGGCTGAGCCCCTTG No data
Right 905397277 1:37674803-37674825 GAGCCCCTTGCTGAGCTGGTAGG No data
905397274_905397282 3 Left 905397274 1:37674790-37674812 CCCAAATGGGGCTGAGCCCCTTG No data
Right 905397282 1:37674816-37674838 AGCTGGTAGGGATATAAGAATGG No data
905397274_905397278 -9 Left 905397274 1:37674790-37674812 CCCAAATGGGGCTGAGCCCCTTG No data
Right 905397278 1:37674804-37674826 AGCCCCTTGCTGAGCTGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905397274 Original CRISPR CAAGGGGCTCAGCCCCATTT GGG (reversed) Intergenic