ID: 905397275

View in Genome Browser
Species Human (GRCh38)
Location 1:37674791-37674813
Sequence GCAAGGGGCTCAGCCCCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905397275_905397282 2 Left 905397275 1:37674791-37674813 CCAAATGGGGCTGAGCCCCTTGC No data
Right 905397282 1:37674816-37674838 AGCTGGTAGGGATATAAGAATGG No data
905397275_905397283 28 Left 905397275 1:37674791-37674813 CCAAATGGGGCTGAGCCCCTTGC No data
Right 905397283 1:37674842-37674864 AGAAAAAAATAAAATCCTGCAGG No data
905397275_905397278 -10 Left 905397275 1:37674791-37674813 CCAAATGGGGCTGAGCCCCTTGC No data
Right 905397278 1:37674804-37674826 AGCCCCTTGCTGAGCTGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905397275 Original CRISPR GCAAGGGGCTCAGCCCCATT TGG (reversed) Intergenic