ID: 905397276

View in Genome Browser
Species Human (GRCh38)
Location 1:37674799-37674821
Sequence GGCTGAGCCCCTTGCTGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905397264_905397276 18 Left 905397264 1:37674758-37674780 CCCCTGCACCATTTCTACCACTT No data
Right 905397276 1:37674799-37674821 GGCTGAGCCCCTTGCTGAGCTGG No data
905397266_905397276 16 Left 905397266 1:37674760-37674782 CCTGCACCATTTCTACCACTTGG No data
Right 905397276 1:37674799-37674821 GGCTGAGCCCCTTGCTGAGCTGG No data
905397265_905397276 17 Left 905397265 1:37674759-37674781 CCCTGCACCATTTCTACCACTTG No data
Right 905397276 1:37674799-37674821 GGCTGAGCCCCTTGCTGAGCTGG No data
905397269_905397276 10 Left 905397269 1:37674766-37674788 CCATTTCTACCACTTGGGTCAAT No data
Right 905397276 1:37674799-37674821 GGCTGAGCCCCTTGCTGAGCTGG No data
905397270_905397276 1 Left 905397270 1:37674775-37674797 CCACTTGGGTCAATTCCCAAATG No data
Right 905397276 1:37674799-37674821 GGCTGAGCCCCTTGCTGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905397276 Original CRISPR GGCTGAGCCCCTTGCTGAGC TGG Intergenic
No off target data available for this crispr