ID: 905397278

View in Genome Browser
Species Human (GRCh38)
Location 1:37674804-37674826
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905397269_905397278 15 Left 905397269 1:37674766-37674788 CCATTTCTACCACTTGGGTCAAT No data
Right 905397278 1:37674804-37674826 AGCCCCTTGCTGAGCTGGTAGGG No data
905397266_905397278 21 Left 905397266 1:37674760-37674782 CCTGCACCATTTCTACCACTTGG No data
Right 905397278 1:37674804-37674826 AGCCCCTTGCTGAGCTGGTAGGG No data
905397265_905397278 22 Left 905397265 1:37674759-37674781 CCCTGCACCATTTCTACCACTTG No data
Right 905397278 1:37674804-37674826 AGCCCCTTGCTGAGCTGGTAGGG No data
905397270_905397278 6 Left 905397270 1:37674775-37674797 CCACTTGGGTCAATTCCCAAATG No data
Right 905397278 1:37674804-37674826 AGCCCCTTGCTGAGCTGGTAGGG No data
905397264_905397278 23 Left 905397264 1:37674758-37674780 CCCCTGCACCATTTCTACCACTT No data
Right 905397278 1:37674804-37674826 AGCCCCTTGCTGAGCTGGTAGGG No data
905397274_905397278 -9 Left 905397274 1:37674790-37674812 CCCAAATGGGGCTGAGCCCCTTG No data
Right 905397278 1:37674804-37674826 AGCCCCTTGCTGAGCTGGTAGGG No data
905397275_905397278 -10 Left 905397275 1:37674791-37674813 CCAAATGGGGCTGAGCCCCTTGC No data
Right 905397278 1:37674804-37674826 AGCCCCTTGCTGAGCTGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type