ID: 905397408

View in Genome Browser
Species Human (GRCh38)
Location 1:37675718-37675740
Sequence CAGTAGGACCAGAGAGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905397406_905397408 1 Left 905397406 1:37675694-37675716 CCACAGTGCTGGGGCAGCTACAA No data
Right 905397408 1:37675718-37675740 CAGTAGGACCAGAGAGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905397408 Original CRISPR CAGTAGGACCAGAGAGAAGC TGG Intergenic
No off target data available for this crispr