ID: 905398597

View in Genome Browser
Species Human (GRCh38)
Location 1:37685076-37685098
Sequence TCGTTCTAGGGTAAGATTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 48}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905398597_905398603 6 Left 905398597 1:37685076-37685098 CCCCAAATCTTACCCTAGAACGA 0: 1
1: 0
2: 0
3: 2
4: 48
Right 905398603 1:37685105-37685127 AATGATACTGTTAAAAACATAGG 0: 1
1: 0
2: 7
3: 84
4: 935

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905398597 Original CRISPR TCGTTCTAGGGTAAGATTTG GGG (reversed) Intronic
905398597 1:37685076-37685098 TCGTTCTAGGGTAAGATTTGGGG - Intronic
908535116 1:65069081-65069103 TCCCACTAGGGTAAGCTTTGAGG + Intergenic
909823007 1:80089571-80089593 TTGTTCTAGGCAAAGATTTTTGG - Intergenic
911219863 1:95234617-95234639 TCTTTATAGGGTGAGATCTGAGG - Intronic
912921019 1:113867235-113867257 TAGTTTTAGGGTAAGTTTTAGGG - Intronic
915039025 1:152952236-152952258 TCCTACCAGGGTAAGATGTGGGG + Intergenic
917746426 1:178012845-178012867 TCGGTTTGGGGGAAGATTTGGGG - Intergenic
921884727 1:220294013-220294035 CGGTTCTAGGGTGTGATTTGAGG + Intergenic
923567044 1:235084040-235084062 TCGTTCTAGGGAAAGGTGTTTGG - Intergenic
1076089755 10:127673012-127673034 TAGGTCTATGGTAAAATTTGAGG - Intergenic
1085520766 11:77137825-77137847 TCCTTCTGGGGTAAGTTTGGGGG - Intronic
1115449424 14:33529030-33529052 TTGTTCTAAGTCAAGATTTGGGG - Intronic
1121495135 14:94386896-94386918 ACCTTATAGGGTAAGCTTTGAGG - Intronic
1127630646 15:60824330-60824352 TTGTTCTTGGATATGATTTGGGG + Intronic
1137960272 16:52875876-52875898 TCTATATAGGGTAAAATTTGGGG + Intergenic
1138082887 16:54108499-54108521 TCCTTCTAGGGGAAGCTCTGGGG - Intronic
1139405699 16:66716071-66716093 TCCTGCTTGGGTGAGATTTGTGG + Intergenic
1155724105 18:29057597-29057619 GAGTTCTAGGGTAGGATTTATGG - Intergenic
1156733131 18:40220585-40220607 TGATTCTAGGGTCAGATATGTGG - Intergenic
1162822606 19:13232110-13232132 TTGGTCTAGGGTGGGATTTGAGG + Intronic
1162966553 19:14158957-14158979 TCATGCTAGTGTAAAATTTGAGG - Intronic
943316373 2:186393613-186393635 TTGTTCTAGTGTAAAATTTTTGG - Intergenic
943341777 2:186691064-186691086 TTATTCTAGGGTAAAATATGTGG + Intergenic
1173089426 20:39956009-39956031 TCCTTCCAGGGTTAGATTTTTGG + Intergenic
1174609931 20:51790684-51790706 CCGTTCCAGTGTAAGATCTGTGG - Exonic
1175238467 20:57528691-57528713 GCGTTCTTGGATAATATTTGTGG + Intergenic
1181437287 22:22918225-22918247 TGGGTCTAGGGTGAGATCTGGGG + Intergenic
949158937 3:858159-858181 CTGTTCTAGTGTAAGGTTTGTGG - Intergenic
949174470 3:1042764-1042786 TGGTTATAGGGTAAATTTTGTGG + Intergenic
949577666 3:5354594-5354616 TCGTTCTAGGCAAAGAATTGGGG - Intergenic
951584377 3:24200369-24200391 TAGGACTAGGGTATGATTTGTGG + Intronic
953088306 3:39696392-39696414 TCTTTCTTGGGAAGGATTTGTGG - Intergenic
955053165 3:55431878-55431900 TCTCTTTAGTGTAAGATTTGGGG - Intergenic
956004908 3:64768522-64768544 TCTGTCCAGGGTGAGATTTGAGG - Intergenic
957876744 3:86156602-86156624 TCGGTCTAGGCAAAGATTTAAGG + Intergenic
967462925 3:189767056-189767078 TTGTTATATGGCAAGATTTGTGG - Intronic
968711812 4:2125021-2125043 TCTTTCTAGGGTTATATTTAGGG + Intronic
976026803 4:80697725-80697747 ACAGTCAAGGGTAAGATTTGTGG + Intronic
984165946 4:176303481-176303503 TTGTTCCAAGGTAAGTTTTGGGG - Intergenic
995743462 5:115378725-115378747 TAGTTCCAAGGTAAGACTTGTGG + Intergenic
1010551795 6:77232346-77232368 TAGTTCTTTGGTAACATTTGGGG + Intergenic
1010665557 6:78625902-78625924 CTGTTCCAGGGTAAGATTTGAGG - Intergenic
1014903826 6:127002543-127002565 TCCTTCTAAGGTAACATTTCTGG + Intergenic
1026442107 7:70453866-70453888 TCCTTGTAAGGTAACATTTGCGG + Intronic
1040533784 8:48288236-48288258 TGGGTCAAGGGTGAGATTTGGGG + Intergenic
1043873284 8:85459010-85459032 TCCTTCTTTGGTAAGATGTGAGG - Intergenic
1045482116 8:102600932-102600954 GCATCCTAGGGTTAGATTTGCGG - Intergenic
1047343995 8:124009723-124009745 CTGTTCTAGGGTGAGAGTTGAGG + Intronic
1048672278 8:136736568-136736590 TCTTTCTAGGTTAACATTTTTGG + Intergenic
1050742733 9:8841078-8841100 TCTTTCTGGGGTAAAATGTGTGG + Intronic
1056452593 9:86730490-86730512 CCCTTCTAGATTAAGATTTGGGG + Intergenic