ID: 905398606

View in Genome Browser
Species Human (GRCh38)
Location 1:37685143-37685165
Sequence ACCTCTTAGAAACTTGATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 148}

Found 19 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905398606_905398620 23 Left 905398606 1:37685143-37685165 CCTTAATCAAGTTTCTAAGAGGT 0: 1
1: 0
2: 1
3: 15
4: 148
Right 905398620 1:37685189-37685211 TTTTGGGGGGGGGGGGTGGGCGG 0: 1
1: 36
2: 279
3: 1705
4: 12656
905398606_905398611 10 Left 905398606 1:37685143-37685165 CCTTAATCAAGTTTCTAAGAGGT 0: 1
1: 0
2: 1
3: 15
4: 148
Right 905398611 1:37685176-37685198 CTCGAATGCTTTTTTTTGGGGGG 0: 1
1: 0
2: 3
3: 33
4: 284
905398606_905398608 7 Left 905398606 1:37685143-37685165 CCTTAATCAAGTTTCTAAGAGGT 0: 1
1: 0
2: 1
3: 15
4: 148
Right 905398608 1:37685173-37685195 TCACTCGAATGCTTTTTTTTGGG 0: 1
1: 0
2: 1
3: 15
4: 163
905398606_905398612 11 Left 905398606 1:37685143-37685165 CCTTAATCAAGTTTCTAAGAGGT 0: 1
1: 0
2: 1
3: 15
4: 148
Right 905398612 1:37685177-37685199 TCGAATGCTTTTTTTTGGGGGGG 0: 1
1: 0
2: 5
3: 69
4: 554
905398606_905398624 27 Left 905398606 1:37685143-37685165 CCTTAATCAAGTTTCTAAGAGGT 0: 1
1: 0
2: 1
3: 15
4: 148
Right 905398624 1:37685193-37685215 GGGGGGGGGGGGTGGGCGGGGGG 0: 4
1: 34
2: 655
3: 2594
4: 14255
905398606_905398609 8 Left 905398606 1:37685143-37685165 CCTTAATCAAGTTTCTAAGAGGT 0: 1
1: 0
2: 1
3: 15
4: 148
Right 905398609 1:37685174-37685196 CACTCGAATGCTTTTTTTTGGGG 0: 1
1: 0
2: 2
3: 18
4: 275
905398606_905398617 16 Left 905398606 1:37685143-37685165 CCTTAATCAAGTTTCTAAGAGGT 0: 1
1: 0
2: 1
3: 15
4: 148
Right 905398617 1:37685182-37685204 TGCTTTTTTTTGGGGGGGGGGGG 0: 4
1: 46
2: 385
3: 1488
4: 4142
905398606_905398610 9 Left 905398606 1:37685143-37685165 CCTTAATCAAGTTTCTAAGAGGT 0: 1
1: 0
2: 1
3: 15
4: 148
Right 905398610 1:37685175-37685197 ACTCGAATGCTTTTTTTTGGGGG 0: 1
1: 0
2: 1
3: 15
4: 236
905398606_905398621 24 Left 905398606 1:37685143-37685165 CCTTAATCAAGTTTCTAAGAGGT 0: 1
1: 0
2: 1
3: 15
4: 148
Right 905398621 1:37685190-37685212 TTTGGGGGGGGGGGGTGGGCGGG 0: 1
1: 3
2: 81
3: 667
4: 4385
905398606_905398615 14 Left 905398606 1:37685143-37685165 CCTTAATCAAGTTTCTAAGAGGT 0: 1
1: 0
2: 1
3: 15
4: 148
Right 905398615 1:37685180-37685202 AATGCTTTTTTTTGGGGGGGGGG 0: 3
1: 7
2: 102
3: 549
4: 2120
905398606_905398622 25 Left 905398606 1:37685143-37685165 CCTTAATCAAGTTTCTAAGAGGT 0: 1
1: 0
2: 1
3: 15
4: 148
Right 905398622 1:37685191-37685213 TTGGGGGGGGGGGGTGGGCGGGG 0: 1
1: 7
2: 98
3: 781
4: 5725
905398606_905398623 26 Left 905398606 1:37685143-37685165 CCTTAATCAAGTTTCTAAGAGGT 0: 1
1: 0
2: 1
3: 15
4: 148
Right 905398623 1:37685192-37685214 TGGGGGGGGGGGGTGGGCGGGGG 0: 1
1: 16
2: 215
3: 2013
4: 10490
905398606_905398625 30 Left 905398606 1:37685143-37685165 CCTTAATCAAGTTTCTAAGAGGT 0: 1
1: 0
2: 1
3: 15
4: 148
Right 905398625 1:37685196-37685218 GGGGGGGGGTGGGCGGGGGGTGG 0: 3
1: 30
2: 650
3: 3248
4: 23598
905398606_905398607 6 Left 905398606 1:37685143-37685165 CCTTAATCAAGTTTCTAAGAGGT 0: 1
1: 0
2: 1
3: 15
4: 148
Right 905398607 1:37685172-37685194 GTCACTCGAATGCTTTTTTTTGG 0: 1
1: 0
2: 1
3: 13
4: 105
905398606_905398614 13 Left 905398606 1:37685143-37685165 CCTTAATCAAGTTTCTAAGAGGT 0: 1
1: 0
2: 1
3: 15
4: 148
Right 905398614 1:37685179-37685201 GAATGCTTTTTTTTGGGGGGGGG 0: 1
1: 6
2: 51
3: 269
4: 1333
905398606_905398613 12 Left 905398606 1:37685143-37685165 CCTTAATCAAGTTTCTAAGAGGT 0: 1
1: 0
2: 1
3: 15
4: 148
Right 905398613 1:37685178-37685200 CGAATGCTTTTTTTTGGGGGGGG 0: 1
1: 0
2: 7
3: 92
4: 581
905398606_905398616 15 Left 905398606 1:37685143-37685165 CCTTAATCAAGTTTCTAAGAGGT 0: 1
1: 0
2: 1
3: 15
4: 148
Right 905398616 1:37685181-37685203 ATGCTTTTTTTTGGGGGGGGGGG 0: 2
1: 22
2: 155
3: 849
4: 3019
905398606_905398619 20 Left 905398606 1:37685143-37685165 CCTTAATCAAGTTTCTAAGAGGT 0: 1
1: 0
2: 1
3: 15
4: 148
Right 905398619 1:37685186-37685208 TTTTTTTGGGGGGGGGGGGTGGG 0: 11
1: 108
2: 578
3: 1915
4: 5256
905398606_905398618 19 Left 905398606 1:37685143-37685165 CCTTAATCAAGTTTCTAAGAGGT 0: 1
1: 0
2: 1
3: 15
4: 148
Right 905398618 1:37685185-37685207 TTTTTTTTGGGGGGGGGGGGTGG 0: 25
1: 258
2: 1094
3: 3164
4: 7879

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905398606 Original CRISPR ACCTCTTAGAAACTTGATTA AGG (reversed) Intronic
902237955 1:15069699-15069721 ACCTATTAGAAATTGGAGTAGGG + Intronic
904197521 1:28796852-28796874 GCCTTGTAGCAACTTGATTAAGG + Intergenic
905398606 1:37685143-37685165 ACCTCTTAGAAACTTGATTAAGG - Intronic
906859544 1:49344185-49344207 AACTCTTAGAAACTTACTTTTGG - Intronic
909517711 1:76531211-76531233 GCCGCTCAGAAAATTGATTATGG + Intronic
910273676 1:85424716-85424738 AGCACTTAGAAATTTCATTAAGG - Intronic
910400089 1:86829657-86829679 ATCTGCTAGAAACTTGATTGTGG + Intergenic
911485142 1:98496221-98496243 ACTTCTTAGAAAATTGAATAGGG - Intergenic
911922873 1:103789381-103789403 ACCTCTTGGCAACTTCAGTAAGG - Intergenic
918706313 1:187667105-187667127 ACCTTTTAGAGAGATGATTAAGG - Intergenic
921374645 1:214461308-214461330 AAGTCTTGGAAACTAGATTATGG - Intronic
922309026 1:224370582-224370604 AGTTCTTAGAAACTTCATTATGG - Intronic
923299102 1:232624316-232624338 ACTTATTAGAAACTTCAATACGG + Intergenic
924627944 1:245711268-245711290 ATCTCTTAGAAACATGCTTTAGG - Intergenic
924844002 1:247746957-247746979 ACCTCTTAGATACTTAAAAAAGG + Intergenic
1063224713 10:4004976-4004998 AGTTCTTTGAAAGTTGATTATGG + Intergenic
1067327984 10:45287792-45287814 ACCTCCAATAAACTTGATTGTGG - Intergenic
1068885731 10:62094828-62094850 ACCTCTGAGATACTTAATTCTGG + Exonic
1070219500 10:74425291-74425313 ACCTCTTTCAAACTTGATGCTGG - Intronic
1073174211 10:101541960-101541982 AACTCTTAGAAAATAGATGAGGG - Intronic
1074255962 10:111802919-111802941 ACTTTTTAGAATCTTGATTCTGG + Intergenic
1074649406 10:115502608-115502630 TCCTCTTATAACCTTTATTAAGG + Intronic
1076317976 10:129556288-129556310 GTCTCTTAGAAAGGTGATTAGGG + Intronic
1077426310 11:2480111-2480133 ACTTCCTAGAAACTTGTTGAAGG - Intronic
1079963695 11:26954442-26954464 ACCTCTGTGAATCTTGCTTATGG - Intergenic
1081392025 11:42540438-42540460 ACCTCTTAGGTAATTAATTAAGG - Intergenic
1082780409 11:57283220-57283242 ACTTCTTAGAAACTGGTTAAAGG + Intergenic
1083821068 11:65171648-65171670 TCCTCTCAGAAACTGGATTCAGG + Intronic
1085246621 11:75107169-75107191 ACCTCTGAGATTCTTTATTAGGG - Intronic
1089760966 11:120722920-120722942 ACCCCTTTTAAACTTCATTAAGG - Intronic
1089998776 11:122934926-122934948 GTCTCTTAGAAAGTTCATTAAGG - Exonic
1090036222 11:123251929-123251951 CCCTGCTAGAAACTTGATTTTGG + Intergenic
1090100444 11:123790471-123790493 ACCTTTTATAACCTTTATTAAGG + Intergenic
1090197609 11:124830416-124830438 ACATTTTAAAAACATGATTAAGG + Intergenic
1093212312 12:16322770-16322792 ACCTGTAAGAAACTAGAGTAGGG - Intergenic
1093925350 12:24903382-24903404 ACCTCGGAGAAACTACATTAGGG + Intronic
1097321926 12:58235248-58235270 ACCTTTTATAAACTTTACTATGG + Intergenic
1097476075 12:60057889-60057911 ACTTCCTAGAAACTTGTTGAAGG + Intergenic
1097792201 12:63826958-63826980 AACTCTGAGAAACTTTAATATGG - Intergenic
1100595595 12:96069088-96069110 ATCTTTTAAAAACTTGATTCAGG + Intergenic
1102886820 12:116528424-116528446 AAGTCTTAGAAACTTGATGTTGG - Intergenic
1103925516 12:124421668-124421690 ATCTCTGAGAAACGTGATTCAGG + Intronic
1107728238 13:43321498-43321520 TCCTTTTAGAATCTTGATTTTGG + Intronic
1108233899 13:48381252-48381274 ACATCTCAGAATCTTGATTCTGG + Exonic
1111309614 13:86466419-86466441 TACTCTTAGAAATTTGATTATGG - Intergenic
1112194675 13:97213477-97213499 ACCTCTCAGAGCCTTGATTCTGG - Intergenic
1114225825 14:20737534-20737556 ACTTCTTAGAAACCTTCTTAAGG - Intronic
1118725589 14:68626684-68626706 ATCTCTTAGAACCTTCAATATGG - Intronic
1119049365 14:71351093-71351115 ACCTCTTTGAAATTTTATAAAGG - Intronic
1121657640 14:95609523-95609545 ACCTCTTAGAATCTAGCATAGGG - Intergenic
1123504420 15:20925638-20925660 ACCTCTTTGAAATCTGATAAAGG + Intergenic
1123561666 15:21499339-21499361 ACCTCTTTGAAATCTGATAAAGG + Intergenic
1123597910 15:21936620-21936642 ACCTCTTTGAAATCTGATAAAGG + Intergenic
1127055407 15:55126171-55126193 TCTTCTTACAAACTAGATTAAGG - Intergenic
1127973670 15:63981673-63981695 ACTTCTTAAAAAGTTTATTATGG - Intronic
1132068790 15:98756550-98756572 ACTTCTAACAAACTTGATTAAGG - Intronic
1202970011 15_KI270727v1_random:226464-226486 ACCTCTTTGAAATCTGATAAAGG + Intergenic
1133447611 16:5875721-5875743 TCCTCTGTGAAAATTGATTAAGG + Intergenic
1136417977 16:30114904-30114926 ACCTCTTAGAACAATGCTTAGGG + Intronic
1137241496 16:46658662-46658684 ACCCCGTATAAACCTGATTATGG - Exonic
1140007214 16:71090231-71090253 ACCACGTAGAAAAGTGATTATGG + Intronic
1146243637 17:31256565-31256587 ACCTCTTTGAAATCTGATAAAGG - Intronic
1153853887 18:9125698-9125720 ATTTCTTAGAAATTTGTTTATGG + Intronic
1154071206 18:11153047-11153069 ACCTCTTACCAACTTAATTAAGG + Intergenic
1154224384 18:12488851-12488873 ATCTCATAGGAAATTGATTAGGG + Intronic
1154391748 18:13942608-13942630 ACCTCAGAGAAACTTTGTTAGGG + Intergenic
1155632672 18:27912402-27912424 AACTTTTAGAAATTTGATTATGG + Intergenic
1158479952 18:57813267-57813289 AACTGTTAGGAACTGGATTAGGG - Intergenic
1158911816 18:62071150-62071172 GCCTCTTAGAATCTTTAATATGG - Intronic
1159194727 18:65098214-65098236 ACCTTTTAGAAAACTGATCAAGG - Intergenic
1162005858 19:7778697-7778719 ACTTCCTAGATACGTGATTATGG + Intergenic
926997573 2:18753299-18753321 AACTCTTACAAACTTGACTAGGG - Intergenic
927074295 2:19561703-19561725 ACCTCTTATAAAATTAATCATGG + Intergenic
928802680 2:35113007-35113029 ACTTCTTAAAAAATTGATAAGGG - Intergenic
928919627 2:36513090-36513112 ACCCCTTAGAAACACCATTAAGG - Intronic
930920690 2:56749976-56749998 ACCTCTGGGAAAATTGATGACGG - Intergenic
931186305 2:59954771-59954793 ACCTTTTAGAAACTGAAATAAGG - Intergenic
932907132 2:75766330-75766352 ACTTCTTAGATCCTTGATTATGG - Intergenic
933187953 2:79299766-79299788 ACCACTTAGAATTTTGCTTAAGG - Intronic
934298237 2:91760445-91760467 TCCTCATGGAAACTTGTTTATGG - Intergenic
935125910 2:100222632-100222654 ACTTCTTACTAACTTGATTCAGG - Intergenic
936015581 2:108956608-108956630 CCCTCATAGATGCTTGATTATGG + Intronic
940963752 2:159814734-159814756 CTCTCTTAGAAACTTTAATACGG + Intronic
942792650 2:179778366-179778388 CCCTCTTAGAAAAGTGTTTATGG - Intronic
943880131 2:193132225-193132247 ACTTATTCGGAACTTGATTAAGG - Intergenic
945455510 2:210047357-210047379 ATCTCTTAGAAAATTGCTGAAGG - Intronic
1170014079 20:11761277-11761299 AACTCTTAGTAAATTGAATATGG - Intergenic
1173851628 20:46222212-46222234 GCCTCTGTGAAACTTGTTTATGG - Intronic
1174959147 20:55135366-55135388 AACTCTGAGAAATTTGATTTTGG + Intergenic
1175082513 20:56432975-56432997 ACCTCTTAAAGACTTGAAAATGG + Intronic
1180752554 22:18134658-18134680 ACCTTTTAAAAAGTTAATTACGG - Intronic
951930737 3:27964298-27964320 ACCTCTCAGAAACTGGAATATGG - Intergenic
953971555 3:47352418-47352440 ATCTTTTAGAAGCTGGATTATGG + Intergenic
954040915 3:47886872-47886894 TCCTGTTAGAAATTTGATTCAGG - Intronic
958519429 3:95164716-95164738 AAATATTGGAAACTTGATTATGG + Intergenic
959549959 3:107643345-107643367 CCCTCTAAGAAACTTCATAATGG - Intronic
960266306 3:115624699-115624721 ACATTTTAGAAACTTGATTGGGG + Intronic
960677027 3:120205139-120205161 ACGTCTTAGAAAATTGGTAATGG + Intronic
962627901 3:137245491-137245513 AGCTCTTAGAAACTTGATATAGG + Intergenic
962680884 3:137799191-137799213 ACTTCTGAGAAACTGAATTAAGG + Intergenic
962886791 3:139635022-139635044 ACCTCTTAGAACTTTCATGAGGG + Intronic
969964573 4:10980798-10980820 TCCTTTTAGAAACCTGTTTAGGG - Intergenic
970741966 4:19249992-19250014 ACCTCCTAGAGACTTGTTGATGG + Intergenic
971089114 4:23319400-23319422 ACCCTTTACACACTTGATTATGG + Intergenic
971620641 4:28850538-28850560 ACCTCCTGGCAACTTGATTTTGG - Intergenic
972384210 4:38548171-38548193 ACCTCTTAGAGAAATGAATAGGG + Intergenic
974452298 4:62081455-62081477 ACCTCTGAGACACTTTATTCAGG + Intergenic
974487483 4:62524250-62524272 ACCTCCTAGAGACTTGTTGAAGG + Intergenic
976479988 4:85530927-85530949 ACCTCATAGTCCCTTGATTATGG - Intronic
977279671 4:95024138-95024160 AACTCTTAGCTACTTGAATAAGG + Intronic
978305556 4:107323948-107323970 ACCTTTTAAAAAATTGATTTGGG - Intergenic
979119628 4:116881139-116881161 ACCTTTCAGAAACTTGTTTCTGG - Intergenic
980837637 4:138216563-138216585 ACTTCACAGAAACTTGAGTAGGG - Intronic
980982030 4:139662989-139663011 ATCTCTTAGAATCTGGATTTGGG + Intergenic
982469216 4:155766752-155766774 GCCTTTTAGAAACTTGCTAAAGG - Intronic
982765256 4:159339559-159339581 ATCTCTTAGGAACTTGTTCAAGG + Intronic
984824533 4:183912819-183912841 ACTTCTTAGAAAGTTGAATGAGG + Intronic
987271412 5:16313411-16313433 ACCTCTAACAAAGTTGTTTAAGG + Intergenic
988229378 5:28454646-28454668 ACCTCTTAGGTACTCAATTAAGG + Intergenic
989262945 5:39438854-39438876 ACCTCTTAAATATTTGATAAAGG + Intronic
993633540 5:90317109-90317131 ACCTTTTAGCACCTTGATTGTGG - Intergenic
994474418 5:100249188-100249210 ACTTCTTGGAAACTGGAGTAAGG + Intergenic
994952628 5:106483841-106483863 ACCTCTTGGAATATTGTTTAGGG + Intergenic
997554654 5:134785001-134785023 AACTCTTGGAAAGTTGAGTAGGG + Intronic
997971220 5:138403866-138403888 ACATCTTATAAATATGATTAAGG + Intronic
1000199087 5:158989694-158989716 ACCTCTTACAGACTTGAGAAAGG - Intronic
1009251018 6:61298814-61298836 CCTTCTTAGAAACTTCTTTATGG - Intergenic
1011464498 6:87641373-87641395 ACCTCTAAGTAACTGGAATAGGG - Intronic
1011689552 6:89853980-89854002 AACTCTGAGAAATCTGATTATGG - Intronic
1012010547 6:93779049-93779071 ATCTCTGAGAAACTTAAATATGG - Intergenic
1013053571 6:106561209-106561231 ACCTCTGAGACTCTTGAGTATGG + Intronic
1013678837 6:112499825-112499847 ACCTGTTTGAAACTTGCTTGGGG + Intergenic
1015360325 6:132332153-132332175 TTCTCTTTGAAACTTGATGAGGG + Intronic
1017468714 6:154719062-154719084 AGCTCTTAGAAACTGGAAAAGGG + Intergenic
1017485445 6:154897928-154897950 ACCTCTGAGGAATATGATTATGG + Intronic
1022021936 7:26408320-26408342 AACTTTTAGAACTTTGATTAGGG + Intergenic
1022284013 7:28938087-28938109 ACATCTTAGAAAAATGTTTAAGG + Intergenic
1022746959 7:33182271-33182293 AACTCTTAGAAACTTACTTTTGG + Intronic
1026071119 7:67120563-67120585 ACCGCTTAGAAACTAAAGTAAGG - Intronic
1026336705 7:69399988-69400010 ACCTCTGACAAATTTAATTAAGG + Intergenic
1027579412 7:79975650-79975672 ATCTCTTAGAAGCTCTATTATGG - Intergenic
1028180036 7:87708987-87709009 ACAACTTAAAAACTAGATTAAGG - Intronic
1028725874 7:94087406-94087428 ACCTCTTAGAGACTTTAATACGG + Intergenic
1030707258 7:112706553-112706575 ACAGCTTAGTAACTTGCTTATGG + Intergenic
1031537977 7:122958674-122958696 AACTCCTAGAAATTTCATTAAGG + Intergenic
1031665678 7:124480191-124480213 ACGTCTTAGAAGCTTTATCATGG + Intergenic
1032846654 7:135757119-135757141 ACCTCCTAGTAACTTCATTCTGG - Intergenic
1039174294 8:34785431-34785453 ACCTCTTAGCCACTCAATTAGGG + Intergenic
1040604987 8:48922669-48922691 ACCTGTTAGAAACAAGAGTAGGG - Intergenic
1040643303 8:49367287-49367309 ACCTCTTGCAAACTTGCTTCTGG + Intergenic
1041050335 8:53928097-53928119 ACATTTTAAAAACTTTATTAAGG + Intronic
1041105461 8:54439139-54439161 AAATGTTATAAACTTGATTATGG - Intergenic
1050097777 9:2085599-2085621 ACCTCTAAGAAAAGTGTTTAAGG - Intronic
1051471995 9:17453943-17453965 AGCTCTCAGAAACTTGATTAGGG + Intronic
1052510616 9:29414594-29414616 ACCTGTTTGAAACTGGATTTAGG + Intergenic
1053918605 9:42965677-42965699 ACCTCTTCTAACCTTGTTTATGG + Intergenic
1056253641 9:84776025-84776047 TCATCTTAGAAACTTCATTGTGG + Intronic
1060084914 9:120689459-120689481 ACATCTTAGAAACATAATTCTGG + Intronic
1190767313 X:53486214-53486236 AACTCTTAGAAACTTCATTGAGG + Intergenic
1194389427 X:93298228-93298250 ACCTTTTACATATTTGATTAAGG - Intergenic
1194473869 X:94334925-94334947 ACTTCCTAGAAACTTGATGAAGG + Intergenic
1197834116 X:130676485-130676507 ACCTCCTAGAAACATTCTTAGGG - Intronic
1197857450 X:130931441-130931463 ACCCCTTAGAGACTTGATGAAGG + Intergenic
1198447139 X:136728454-136728476 ATCCCTTAGAAACTTGAAAAAGG + Intronic
1201943222 Y:19482329-19482351 ACATCTCAGAAAATTGATTCTGG + Intergenic