ID: 905399695

View in Genome Browser
Species Human (GRCh38)
Location 1:37692346-37692368
Sequence AGGAGTACCCGCGACGGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 46}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905399689_905399695 -6 Left 905399689 1:37692329-37692351 CCTGGACCACAACTCCCAGGAGT 0: 1
1: 0
2: 3
3: 18
4: 231
Right 905399695 1:37692346-37692368 AGGAGTACCCGCGACGGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 46
905399683_905399695 28 Left 905399683 1:37692295-37692317 CCGGGTGGGTTGGTGGGGAGGGC 0: 1
1: 9
2: 2
3: 48
4: 385
Right 905399695 1:37692346-37692368 AGGAGTACCCGCGACGGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905399695 Original CRISPR AGGAGTACCCGCGACGGCGG CGG Intergenic
901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG + Intronic
905399695 1:37692346-37692368 AGGAGTACCCGCGACGGCGGCGG + Intergenic
906154528 1:43606268-43606290 AGGAGCAGCGGCGGCGGCGGCGG + Exonic
908534636 1:65066702-65066724 CGGAGTCCCCGCGGCGGCGGCGG - Intergenic
912246279 1:107964927-107964949 CGGAGGAACCGCGGCGGCGGCGG - Exonic
916507970 1:165445166-165445188 AAGAGTAGCGGTGACGGCGGCGG - Exonic
917962338 1:180154935-180154957 AGCAGCAGCAGCGACGGCGGCGG - Exonic
1071997522 10:91162885-91162907 AGCAGAGCCCGCGGCGGCGGCGG - Intergenic
1080606604 11:33869493-33869515 AGGAGCGGCGGCGACGGCGGCGG - Exonic
1084151358 11:67289331-67289353 AGCAGTAGCGGCGGCGGCGGCGG - Exonic
1085423208 11:76381070-76381092 AGGTGCACCAGCGGCGGCGGCGG - Intergenic
1106340217 13:28820166-28820188 AGGAGCAGCCGCGGCCGCGGCGG + Intergenic
1106413000 13:29524096-29524118 AGGAGGACCCGGGACCGCAGTGG + Intronic
1108690016 13:52851289-52851311 GGAAGTAGCCACGACGGCGGCGG + Intergenic
1119341986 14:73886955-73886977 GGTAGTACCCGAGAGGGCGGGGG + Intronic
1123630702 15:22258107-22258129 AGGGGGACCCGCGGCGGCCGGGG - Intergenic
1128987428 15:72231328-72231350 AGGAGGAAGCGCGGCGGCGGCGG + Exonic
1132837234 16:1960069-1960091 AGGGGTGCCCGGGGCGGCGGGGG - Intronic
1140225226 16:73071484-73071506 AGCAGTATCGGCGGCGGCGGCGG - Intergenic
1143539757 17:7561990-7562012 AGGAGTGGCGGCGGCGGCGGTGG + Exonic
1144548000 17:16215485-16215507 AGCAGCAGCCGCGGCGGCGGCGG - Exonic
1145248464 17:21284792-21284814 AGGAGCAGCGGCGGCGGCGGCGG - Exonic
1150108413 17:62478598-62478620 AGGGGACCCCGCGCCGGCGGAGG - Intronic
1160406955 18:78652830-78652852 AGGAGTTCCCGGGACTGAGGGGG - Intergenic
1167466229 19:49652197-49652219 GGGAGAAGCGGCGACGGCGGCGG + Exonic
927990220 2:27442327-27442349 AGGGGGACCCGGGACGGAGGCGG + Intergenic
930189207 2:48440803-48440825 AGGAGGAGGCGCGGCGGCGGCGG + Exonic
944811120 2:203328406-203328428 AGGAGCGGCGGCGACGGCGGCGG - Exonic
1175429376 20:58891245-58891267 AGGAGCGGCCGCGGCGGCGGCGG - Intronic
1181026857 22:20131833-20131855 CGCAGGACCCGCGGCGGCGGCGG - Intronic
1181147481 22:20859003-20859025 AGGAGTTCGCGCGACGACCGCGG + Exonic
1183912887 22:41092236-41092258 AGGAGGCCCCGCTCCGGCGGCGG - Exonic
956851856 3:73235801-73235823 AGGACTACTCGAGACGGCAGTGG - Intergenic
959539394 3:107523212-107523234 AGGAGCAGCGGCGGCGGCGGCGG + Intronic
961827631 3:129606996-129607018 AGGAGAGCGAGCGACGGCGGCGG - Intergenic
970689212 4:18602814-18602836 AGGAGTGCCCGCCATTGCGGAGG - Intergenic
978617927 4:110614361-110614383 GGGAGTCCCGGCGACGGCGGCGG + Intergenic
986668883 5:10126375-10126397 AGGAGTGCCAGGGACGGCTGCGG - Intergenic
992312093 5:75511447-75511469 AGGGGTCACGGCGACGGCGGCGG - Exonic
1002897044 6:1385281-1385303 AGGAGGACGCGCGGAGGCGGGGG - Intergenic
1010083143 6:71886886-71886908 AGGAGGAGCAGCGGCGGCGGCGG - Intronic
1012624946 6:101393659-101393681 AGGAGCAGCAGCGGCGGCGGCGG - Intergenic
1018613077 6:165662255-165662277 AGTAGTCACCGCGGCGGCGGTGG - Intronic
1038972072 8:32647256-32647278 AGGAGGACCAGCGGCGGTGGCGG - Intronic
1047382025 8:124372664-124372686 AGGGGTAGCGGCGGCGGCGGCGG - Exonic
1050151289 9:2621801-2621823 CGGAGCACCCGCACCGGCGGCGG - Intergenic
1189310434 X:40014122-40014144 AGGAGAGGCGGCGACGGCGGGGG - Intergenic
1195773445 X:108377000-108377022 AGGGGGACCCGCGCCGGCCGCGG + Intronic
1197754457 X:129984180-129984202 AGGAGCAGCAGCGGCGGCGGCGG - Intronic