ID: 905401419

View in Genome Browser
Species Human (GRCh38)
Location 1:37706402-37706424
Sequence GTTGATGAACAGATGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 342}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905401419_905401422 5 Left 905401419 1:37706402-37706424 CCGGCCTCCATCTGTTCATCAAC 0: 1
1: 0
2: 2
3: 27
4: 342
Right 905401422 1:37706430-37706452 TTTGCCCATCCGATTGTAGTAGG 0: 1
1: 0
2: 1
3: 3
4: 43
905401419_905401427 24 Left 905401419 1:37706402-37706424 CCGGCCTCCATCTGTTCATCAAC 0: 1
1: 0
2: 2
3: 27
4: 342
Right 905401427 1:37706449-37706471 TAGGCCCAAGAAGTAGACATGGG 0: 1
1: 0
2: 0
3: 11
4: 98
905401419_905401428 25 Left 905401419 1:37706402-37706424 CCGGCCTCCATCTGTTCATCAAC 0: 1
1: 0
2: 2
3: 27
4: 342
Right 905401428 1:37706450-37706472 AGGCCCAAGAAGTAGACATGGGG 0: 1
1: 0
2: 1
3: 11
4: 168
905401419_905401426 23 Left 905401419 1:37706402-37706424 CCGGCCTCCATCTGTTCATCAAC 0: 1
1: 0
2: 2
3: 27
4: 342
Right 905401426 1:37706448-37706470 GTAGGCCCAAGAAGTAGACATGG 0: 1
1: 0
2: 0
3: 8
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905401419 Original CRISPR GTTGATGAACAGATGGAGGC CGG (reversed) Intronic
900498748 1:2989373-2989395 GAGGATGAATAGATGGAGGATGG - Intergenic
902873474 1:19327548-19327570 CTGGGTGAACAGATGGAGGGAGG - Intronic
903670250 1:25031182-25031204 GAGGATGAAGGGATGGAGGCTGG + Intergenic
905401419 1:37706402-37706424 GTTGATGAACAGATGGAGGCCGG - Intronic
906234138 1:44193586-44193608 GTTGATGAACAGAAGCAGAAGGG + Intergenic
906482773 1:46210724-46210746 GTAGCTGAACAGATGGAGGGTGG - Intronic
906935883 1:50213778-50213800 TTTGATGAAAATCTGGAGGCAGG - Intergenic
907354909 1:53864143-53864165 GTTGGTGAGGAGAAGGAGGCAGG - Intronic
907564463 1:55421959-55421981 GTTGATGCAAAGGTGGGGGCGGG + Intergenic
908091372 1:60689006-60689028 GTTGAAGATCAGATGGTTGCAGG - Intergenic
912501582 1:110126189-110126211 GTTGGAGGACAGAAGGAGGCAGG + Intergenic
912755774 1:112323913-112323935 GATGATAGACAGATGGAGGGAGG + Intergenic
912843454 1:113059385-113059407 GCTGGTGAACAGAGTGAGGCTGG + Intergenic
914196422 1:145450353-145450375 AATGATGAACAGGTGGAGGGAGG + Intergenic
915203821 1:154254042-154254064 GGTGATGAAGAGATGGAGCTGGG - Exonic
916943701 1:169702602-169702624 GTGGATGAGCAGAGAGAGGCAGG - Intronic
917088031 1:171323213-171323235 GAAGATGAATAGATGGGGGCTGG + Intronic
917272493 1:173293323-173293345 GTTGATGATCAGATGGTTGTAGG - Intergenic
918157646 1:181864825-181864847 GTTGCTGATGAAATGGAGGCAGG - Intergenic
918614334 1:186527130-186527152 GTTGAAGATCAGATGGTTGCTGG + Intergenic
919236096 1:194844315-194844337 GTTGAGAAGCAGATGGATGCTGG + Intergenic
921109789 1:212024003-212024025 GTTGAAGATCAGATGGCTGCAGG + Intronic
921194634 1:212743494-212743516 GTTAATGAACATGTGGAGGAAGG - Intronic
921402240 1:214738274-214738296 ACTGAAGAAGAGATGGAGGCTGG + Intergenic
921961346 1:221037983-221038005 GTTGAAGATCAGATGGTTGCAGG + Intergenic
922242567 1:223765498-223765520 GTTTCTGCACAGATGGAGGGTGG + Intronic
923084047 1:230688699-230688721 ATTGATGAAGAGAGGGAGGTTGG + Intronic
923811016 1:237316011-237316033 GGAGATGAAGAGATGGGGGCAGG + Intronic
1062940218 10:1415185-1415207 GTGGGTGAACAGATGGTGGATGG + Intronic
1063877603 10:10496549-10496571 ATGGATGAAAAGATGGAGGGTGG + Intergenic
1064172308 10:13044635-13044657 GTTGAAGATCAGATGGCTGCAGG + Intronic
1064296695 10:14085104-14085126 ATTTATAAACAGATGGAGGTGGG - Intronic
1065830631 10:29610755-29610777 ATTCATGAAAAGATGGAGGTTGG - Intronic
1070701972 10:78610562-78610584 GGTGATGAAGTGCTGGAGGCAGG + Intergenic
1070816143 10:79324784-79324806 CTTGATGCACCGATGGACGCAGG + Intergenic
1071217490 10:83425195-83425217 GTTGAGGAACAGAGGGTGACTGG - Intergenic
1071490328 10:86131876-86131898 GTTGGTAAACAGATGGAGGGTGG - Intronic
1072066922 10:91880293-91880315 TTTGAGGAACAGATGGACTCTGG - Intergenic
1072212017 10:93254625-93254647 TTTGATGAGCAGATGGGGGCTGG + Intergenic
1072368430 10:94739077-94739099 GTTGAAGATCAGATGGATGTAGG + Intronic
1072742152 10:97915862-97915884 GTGGAGGAACAGAGGGAGGCTGG - Intronic
1072864490 10:99043186-99043208 GTTCTTAAACAGCTGGAGGCCGG + Intronic
1074105118 10:110383403-110383425 GTTGTTGAGCAAATGAAGGCAGG - Intergenic
1074230636 10:111531657-111531679 GTTGAGGAAGAGACGGAGACAGG - Intergenic
1074365911 10:112857354-112857376 ATTGATGAACAAATGAAGGAAGG - Intergenic
1074685853 10:115961939-115961961 ATAGATGACCAGATGGAGGCAGG + Intergenic
1074691039 10:116004348-116004370 GTAGATGGAGACATGGAGGCTGG - Intergenic
1075817033 10:125272243-125272265 GATGATGGACACATGGATGCTGG + Intergenic
1075818133 10:125282312-125282334 GATGATGGACACATGGATGCTGG - Intergenic
1076073541 10:127513544-127513566 GTTGACAAAAATATGGAGGCAGG - Intergenic
1076825097 10:132963249-132963271 GTTGACGGACAGATGGAGGGAGG - Intergenic
1076825105 10:132963279-132963301 GTTGATAGACAGATGGATGGAGG - Intergenic
1076825110 10:132963309-132963331 TTTGATGGACAGATGGAGGGAGG - Intergenic
1076825118 10:132963339-132963361 GTTGATAGACAGATGGATGAAGG - Intergenic
1076825122 10:132963369-132963391 GTTGATGGACAGATGGAGGGAGG - Intergenic
1076825130 10:132963399-132963421 GTTGATGGACGGATGGATGGAGG - Intergenic
1076825137 10:132963429-132963451 GTTGATGGACGGATGGATGGAGG - Intergenic
1076825143 10:132963455-132963477 GTTGATGGACGGATGGATGGAGG - Intergenic
1076825151 10:132963485-132963507 GTTGATGGACGGATGGATGGAGG - Intergenic
1076825159 10:132963515-132963537 GTTGATGGACGGATGGATGGAGG - Intergenic
1077280503 11:1742895-1742917 ATGGATGGACAGATGGAGGATGG + Intronic
1077280515 11:1742952-1742974 GAGGATGGACAGATGGAGGATGG + Intronic
1077280556 11:1743142-1743164 ATGGATGGACAGATGGAGGATGG + Intronic
1077280576 11:1743274-1743296 ATGGATGGACAGATGGAGGATGG + Intronic
1077280591 11:1743354-1743376 GAGGATGGACAGATGGAGGATGG + Intronic
1077280606 11:1743430-1743452 GATGAAGGACAGATGGAGGATGG + Intronic
1077352079 11:2097689-2097711 ATTAATGAAGAAATGGAGGCTGG - Intergenic
1077353214 11:2102547-2102569 GTGGATGAACAGTTGGATGGAGG + Intergenic
1077955069 11:7009278-7009300 GTTGAAGATCAGATGGTGGTAGG - Intronic
1079338247 11:19589967-19589989 GTTGAGGCACAGAGAGAGGCAGG - Intronic
1079595614 11:22242178-22242200 GTTGAAGACCAGATGGTGGGAGG + Intronic
1081129875 11:39365796-39365818 GTTGATGAGAAGATAGAGGAGGG + Intergenic
1082810446 11:57476337-57476359 GTTGTTGAACAGGTAGAGGATGG - Exonic
1083049999 11:59768602-59768624 GTTGATGAGCAGAAGGTGTCTGG + Intronic
1084530107 11:69722166-69722188 GTTGGTGGACAGATGGAAGATGG + Intergenic
1084596472 11:70119693-70119715 GTGGGTGAATAGATGGATGCCGG + Intronic
1084740004 11:71133410-71133432 ATGGATGGACAGATGGAGGGAGG + Intronic
1084841126 11:71849383-71849405 GTTTATGAACAGATGGATAAAGG - Intergenic
1085354423 11:75822787-75822809 GTTGCTGAACATGTGGAGGGTGG - Intronic
1086186003 11:84016640-84016662 GTTGATGATCAGATGGTTGTAGG + Intronic
1089644259 11:119868010-119868032 GTTTCTGGCCAGATGGAGGCAGG + Intergenic
1089795524 11:120977517-120977539 GTTGAAAAACAGATGGAGCGGGG - Intronic
1090096732 11:123749516-123749538 GTTGAAGATCAGATGGTTGCAGG + Intergenic
1090895265 11:130966524-130966546 GTTGATGATCAGATGGTTGTAGG + Intergenic
1091833417 12:3567117-3567139 GTTGATCCACAGATGGAGAGGGG - Intronic
1093134455 12:15433647-15433669 GTTGAAGATCAGATGGATGTAGG + Intronic
1093185074 12:16010613-16010635 GTTTATGAACAGAAGGAGAGAGG + Intronic
1095208687 12:39467975-39467997 GGTGAGGAAAAGTTGGAGGCTGG + Intergenic
1095969979 12:47894877-47894899 GTGGATCCACAGGTGGAGGCAGG - Intronic
1096238380 12:49944983-49945005 GTTGAGGCCCAGGTGGAGGCAGG - Intergenic
1096551051 12:52371872-52371894 GTTGCTGAACACAGGGAGACCGG - Intergenic
1099381758 12:81963232-81963254 GTTGAAGATCAGATGGTTGCGGG - Intergenic
1103205643 12:119126666-119126688 GTTGATGAGAAGAAGGAGGAAGG + Intronic
1104425681 12:128675716-128675738 GTGGGTGGACAGATGGAGGAAGG + Intronic
1105237482 13:18571885-18571907 GTAGATGAACACATGGAATCAGG - Intergenic
1106100456 13:26690892-26690914 ATTGATGAACAGATGGAGAGGGG - Intergenic
1106336463 13:28788175-28788197 TTTGATGAACTGATGGAAGTAGG - Intergenic
1107661202 13:42641433-42641455 GTTGAAGATCAGATGGTTGCAGG + Intergenic
1110614058 13:77521571-77521593 GGTGATAAAAAGATAGAGGCTGG + Intergenic
1112950379 13:104988316-104988338 GATGAGGAAGAGATGGGGGCAGG + Intergenic
1113272675 13:108691832-108691854 TTTGATGAACAGAGGTAAGCCGG + Intronic
1114434426 14:22692882-22692904 GTTGAAGATCAGATGGATGTAGG + Intergenic
1114547973 14:23516058-23516080 GGTGCTGAAGAGATGGGGGCAGG + Intergenic
1115029298 14:28774981-28775003 GTTGTTGGCCAGAGGGAGGCCGG + Intronic
1116933727 14:50716013-50716035 TTTGATGAAATGATGGGGGCGGG + Intergenic
1117506472 14:56408502-56408524 GTTGATGATCAGATGGTTGTAGG - Intergenic
1117679293 14:58186868-58186890 GGTGAGAAACAGAAGGAGGCAGG + Intronic
1119816681 14:77575208-77575230 ATTGATGCATAGATGGATGCAGG - Intronic
1121530042 14:94645987-94646009 GTGGATGGACAGATAGATGCTGG + Intergenic
1122139109 14:99651779-99651801 GTTTTTCAACAGATAGAGGCCGG + Intronic
1122259671 14:100507195-100507217 GTTGAAGATCAGATGGCTGCAGG + Intronic
1123633137 15:22275485-22275507 GTGGATGAAACGATGGAAGCAGG - Intergenic
1124704385 15:31950062-31950084 GTTGAAGATCAGATGGATACAGG + Intergenic
1125588621 15:40840236-40840258 GGTGAGGGACAGATGAAGGCAGG + Intergenic
1125622915 15:41080557-41080579 TTTAATAAACAGATTGAGGCCGG + Intronic
1126220087 15:46203605-46203627 GTTTTTAATCAGATGGAGGCTGG + Intergenic
1127721230 15:61701979-61702001 GTTTATGAAAAGTTGGAGTCAGG - Intergenic
1127766896 15:62195209-62195231 GTTGAGGAAAAGATGGAGTTTGG + Intergenic
1128043745 15:64598410-64598432 GTAGATCAGCAGATAGAGGCTGG - Intronic
1128681841 15:69658089-69658111 GTGGGTCAAGAGATGGAGGCAGG - Intergenic
1129327672 15:74809713-74809735 GAGGAGGAGCAGATGGAGGCAGG + Intergenic
1129584563 15:76849409-76849431 GTTGATGAACAGGAGGTGGGCGG - Intronic
1129732501 15:77940182-77940204 GCAGAGGAACAGAGGGAGGCGGG - Intergenic
1130993531 15:88891174-88891196 GTTGACAAAGAGATGCAGGCCGG - Intronic
1131257837 15:90873260-90873282 GTTGTTGGATAGAGGGAGGCTGG + Intronic
1131706296 15:94999821-94999843 GGTGGTGAACAGGTGGTGGCAGG + Intergenic
1135630485 16:24032533-24032555 GTGGATTAGCAGATGGAGGTGGG + Intronic
1136145418 16:28313638-28313660 GTTCATGAATGGAGGGAGGCAGG + Intronic
1137386075 16:48043854-48043876 GATGATGAATAGATGGATGGTGG - Intergenic
1139084644 16:63570016-63570038 GTCTTTCAACAGATGGAGGCAGG - Intergenic
1139202719 16:64995443-64995465 GTTGATGATCAGATGGCTGTAGG - Intronic
1139611114 16:68059462-68059484 GTGGAAGGACAGATGGAGCCAGG + Intronic
1140514161 16:75530241-75530263 GATGATGAAGAGCAGGAGGCAGG + Exonic
1141596501 16:85100153-85100175 ACTGAAGAACAGATGGAGGGGGG + Exonic
1141854945 16:86674343-86674365 ATGGATGAAGAGATGGAGGGAGG - Intergenic
1141943514 16:87294320-87294342 GTAGATGAATGGATGGTGGCTGG + Intronic
1142694992 17:1628641-1628663 GATGACGAACAGATGCGGGCTGG - Intronic
1143667073 17:8369119-8369141 GCTGGTGAACAGATGGCTGCTGG - Exonic
1145278959 17:21454757-21454779 GGTGATGAACAGAAGCAGGGAGG - Intergenic
1146614145 17:34338554-34338576 GTTGAAGATCAGATGGTTGCAGG + Intergenic
1146826734 17:36029614-36029636 GTGGATGAACAGATGGACAGAGG - Intergenic
1148625028 17:49062727-49062749 GTTGATAAACATTGGGAGGCAGG + Intergenic
1148781660 17:50125609-50125631 GTGGATGGACAGATGGCGGCAGG - Intronic
1148792690 17:50182404-50182426 ATTGATCAAGAGATGGAGCCTGG + Intergenic
1152103481 17:78316009-78316031 GTGGGTGCACAGATCGAGGCTGG - Intergenic
1152784987 17:82243061-82243083 GTTGAAGTACAGAGGGAGGTTGG - Exonic
1155519259 18:26652719-26652741 ATTGTTGAACAAATGGAGGGAGG + Intronic
1157147784 18:45183082-45183104 GCTTATGAACAGATGGACCCAGG - Intergenic
1157557423 18:48621914-48621936 GTGGATGAACCGCTGGGGGCTGG - Intronic
1158346481 18:56521512-56521534 GTTGCTGAACACAGGGAGGGAGG - Intergenic
1159251084 18:65877644-65877666 TGGGATGCACAGATGGAGGCAGG - Intronic
1159479055 18:68963578-68963600 AGTGAAGAACAGATGGAGCCAGG - Intronic
1160158818 18:76455441-76455463 GCTCAGGGACAGATGGAGGCTGG + Intronic
1161633119 19:5369343-5369365 GTGGATGAATAGATGGATGATGG - Intergenic
1161719460 19:5895025-5895047 ACTGATGCACAGAGGGAGGCCGG + Intronic
1161873279 19:6887092-6887114 GTTGGTGAATAGAGGGAGGGAGG + Intergenic
1161931740 19:7345192-7345214 TTTGAGGAACAGAAGGAAGCAGG - Intergenic
1162292280 19:9789249-9789271 GGTGATGGAGAGATGGGGGCGGG - Intronic
1162723573 19:12676491-12676513 TGTGGTGAACAGATGGTGGCAGG - Intronic
1163572527 19:18090846-18090868 GATCAGGAACAGATGGAGGCCGG + Intronic
1164210524 19:23093781-23093803 GTTGATCAACAGACGGGGTCAGG + Intronic
1164719639 19:30423026-30423048 GTAGATGAGCAGATGAAGGGAGG - Intronic
1164719653 19:30423082-30423104 GTAGATGAGCAGATGAAGGGAGG - Intronic
1166707188 19:44914588-44914610 GTGGGTGGACAGAGGGAGGCAGG + Intronic
1167144247 19:47672441-47672463 GTGGATGGAAAGATGGAGGGAGG + Intronic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167233755 19:48301637-48301659 ATGGATGAACAGATGGATGTGGG + Intronic
1167614758 19:50526339-50526361 GTTGAAGGACAGATGCAGGGAGG - Intronic
1168070413 19:53947204-53947226 ATTGATAAACAGATGGAACCAGG - Intergenic
925211999 2:2057346-2057368 GGTGATGAACAGGAAGAGGCTGG - Intronic
926156067 2:10454631-10454653 TTGGATGGACTGATGGAGGCTGG - Intergenic
926221070 2:10935712-10935734 GTGAATGAACAGCAGGAGGCCGG - Intergenic
926808758 2:16737857-16737879 CTTGATGTATAGATGGAGGAAGG - Intergenic
928317536 2:30257649-30257671 GTTCAGGAACAGATGCTGGCTGG - Exonic
928608779 2:32970549-32970571 GTTGAAGATCAGATGGTGGTCGG + Intronic
929032096 2:37658691-37658713 CTTGATGTAGAGATGGAGGCGGG - Intronic
929598555 2:43191004-43191026 GCAGATGAAAAAATGGAGGCTGG + Intergenic
930868642 2:56147876-56147898 GTTGGTGACCAGATGAAGGTGGG + Intergenic
930987349 2:57606633-57606655 GTTGAAGAACAGATGGTTGTAGG - Intergenic
931364151 2:61604080-61604102 AGTGATGAATAGATGGAGGTGGG + Intergenic
931804205 2:65788782-65788804 CCTGAGTAACAGATGGAGGCAGG - Intergenic
933887254 2:86730078-86730100 GTTGGTGCACAGATGGAGTCTGG + Intronic
933922921 2:87066635-87066657 GTTGGTGCACAGATGGAGTCTGG - Intergenic
934775084 2:96932246-96932268 GATGATGCCCAGCTGGAGGCTGG - Intronic
935197676 2:100828686-100828708 GTTGATGCTCAGATGGCTGCAGG + Intronic
935330999 2:101978239-101978261 GTTGATGAGCAGGTGCAGCCAGG + Intergenic
935696248 2:105773372-105773394 GTGCATGGACTGATGGAGGCCGG - Intronic
936018240 2:108975506-108975528 CTTGGTGACCAGATGGATGCCGG + Intronic
939252913 2:139706036-139706058 GTTGGTGCACAGAGGGAGGCAGG + Intergenic
939966008 2:148610889-148610911 GGTGGAGAACAGATGGAGGAAGG + Intergenic
940391939 2:153142352-153142374 GATGATAAACACATGGAGGAAGG + Intergenic
940806641 2:158194879-158194901 GTGGATGAGCAGATGGGGGATGG - Intronic
940849161 2:158672003-158672025 CTTGAGGAACAGAGGGAAGCCGG + Intronic
940875458 2:158893245-158893267 GTGGAGGAACAGATGGCTGCAGG + Intergenic
941065720 2:160900434-160900456 GCTAATGAAAATATGGAGGCTGG + Intergenic
941849616 2:170166111-170166133 TTTGATGAACAAATGAAGGAAGG - Intergenic
941872255 2:170398349-170398371 GTTGGTGAACACATGGGTGCTGG - Intronic
942797872 2:179842696-179842718 TTTGCTGAACAGCTGGAGGGAGG - Intronic
943214740 2:185016124-185016146 GTTTAAGAATAGCTGGAGGCCGG + Intergenic
944602604 2:201319211-201319233 GTTGAAGATCAGATGGATGTAGG - Intronic
948129549 2:235590459-235590481 GTTGATCAACAGGTGTGGGCAGG + Intronic
948680575 2:239631563-239631585 GTTGATGGGCTGATGGAGGTAGG + Intergenic
948940210 2:241191528-241191550 GTGGCTGAACAGCTGGAGGATGG - Intronic
1169336362 20:4760404-4760426 GCAGATGAAGAAATGGAGGCAGG + Intergenic
1171105594 20:22429749-22429771 ACTGATAAACAGATGGGGGCTGG + Intergenic
1171235330 20:23519717-23519739 GTTTACGGACAGATGCAGGCAGG + Intergenic
1174094429 20:48076942-48076964 TTTAATGCAGAGATGGAGGCAGG - Intergenic
1174933282 20:54839548-54839570 GTTAATGAGCAAGTGGAGGCCGG + Intergenic
1175045416 20:56100371-56100393 GTTGGGGAACAGATAGAAGCAGG + Intergenic
1175053549 20:56177301-56177323 GTTCATGAACAGATGAAGTGGGG - Intergenic
1175779247 20:61671877-61671899 GTGGATGGACAGATGGAGGATGG + Intronic
1176069932 20:63220923-63220945 GTGGATGGACAGCAGGAGGCAGG + Intergenic
1176294993 21:5067085-5067107 GTTGCTGACCATATGGAGCCAGG - Intergenic
1176781471 21:13200163-13200185 GTAGATGAACACATGGAATCAGG - Intergenic
1177396119 21:20538200-20538222 GTTCCTGCACAGATGGGGGCAGG - Intergenic
1177979174 21:27889312-27889334 GTAGATGAACACATGGAATCAGG - Intergenic
1178775356 21:35544963-35544985 GTTGAGGGACACATGGAAGCAGG - Intronic
1179421355 21:41239171-41239193 GTTTATGAGCAGATGGGGGTGGG + Intronic
1179623705 21:42635164-42635186 GTGGATGAACAGATGGACAATGG - Intergenic
1179862056 21:44195043-44195065 GTTGCTGACCATATGGAGCCAGG + Intergenic
1182325711 22:29511222-29511244 GTTGGTCAACAGCTGGTGGCTGG + Exonic
1183262291 22:36803516-36803538 ATGGATGGACAGATGGAGGGAGG + Intronic
1183277649 22:36910278-36910300 GTTGAAGATCAGATGGCTGCGGG + Intergenic
1184293093 22:43508649-43508671 GATGATGGATAGATGGAGGGAGG - Intergenic
1184344318 22:43903662-43903684 TTTAATGAACAGAAGGAGTCCGG - Intergenic
1185063948 22:48621338-48621360 GTGGATGAAATGATGGAAGCAGG - Intronic
1185140754 22:49099873-49099895 GTTCAGGAACAGAGGGATGCAGG + Intergenic
1185146282 22:49138578-49138600 GTGGATGAATAGATGGATGGAGG - Intergenic
949526322 3:4908221-4908243 GCTAATGAACAGCTGGAGTCAGG + Intergenic
950102838 3:10368684-10368706 GTGGATGGACAGATGGATGGCGG - Intronic
950689356 3:14643356-14643378 GCAGATGAGGAGATGGAGGCCGG - Intergenic
951047364 3:18055302-18055324 GTTGATGATCAGATGGCTGTAGG + Intronic
955139477 3:56255148-56255170 GTAGATGAAAAGATGGAGAAAGG - Intronic
955245386 3:57220129-57220151 GTTGAAGATCAGATGGTTGCAGG + Intronic
955362007 3:58283697-58283719 GTTAATGCAGAGATGGAGGTTGG + Intronic
955739986 3:62080370-62080392 GTTTAAGAACAGAAGGGGGCTGG - Intronic
956748321 3:72327129-72327151 GTGGTTGAATAGATGGAGGATGG - Intergenic
956951633 3:74290463-74290485 GTTGTTGAACAGCTTAAGGCAGG - Intronic
957708200 3:83817454-83817476 GTTAGTGAACAGGTGAAGGCAGG + Intergenic
957772676 3:84714908-84714930 GTTGAAGATCAGATGGTTGCAGG - Intergenic
958173836 3:89970271-89970293 GTTGAGCAAAAGATGGAGGAAGG - Intergenic
958460693 3:94390906-94390928 GTTGAAGAACAGATGGCTGTAGG - Intergenic
959680265 3:109087927-109087949 GTTGATGATCAGATGGTTGTAGG - Intronic
959738705 3:109690641-109690663 GTTGAAGATCAGATGGCTGCAGG + Intergenic
960059252 3:113303090-113303112 GTTGATGACAATATGGAGCCTGG + Intronic
962627557 3:137241585-137241607 GTTGAGGAGCAGCTGGAGGCCGG + Intergenic
963493420 3:146029895-146029917 GTGGAAGAACAGATGGTTGCAGG + Intergenic
963999874 3:151757472-151757494 GTTCATGAACATATTGAGGATGG + Exonic
964305613 3:155336363-155336385 GTTGCTGAACACGTGGAGGGTGG - Intergenic
964739954 3:159954716-159954738 ATGTATGAACAGAAGGAGGCAGG + Intergenic
967622056 3:191645445-191645467 GTTGATGATCAGATAGTTGCAGG - Intergenic
969424823 4:7118068-7118090 GTGGATGGATAGATGGAGGAAGG + Intergenic
969599351 4:8166817-8166839 GTGGATGGACAGATGGATGGAGG - Intergenic
969782223 4:9415409-9415431 GTTTATGAACAGATGGATAAAGG - Intergenic
970582095 4:17482820-17482842 GGTGAGGAACACAGGGAGGCTGG - Intronic
971530962 4:27688296-27688318 GTTGAAGATCAGATGGCTGCAGG + Intergenic
971967893 4:33585745-33585767 GTTGGGGAAGAGAAGGAGGCAGG + Intergenic
977918513 4:102619450-102619472 TTTGATGAAAGGAGGGAGGCAGG - Intergenic
978607896 4:110502563-110502585 GTTGAAGATCAGATGGTTGCAGG + Intronic
979097379 4:116567895-116567917 GTTGAAGAACAGATGGTTGTAGG - Intergenic
981425737 4:144600854-144600876 GTTGACAAACTGATGAAGGCTGG + Intergenic
981460108 4:145003631-145003653 GTTGAAGATCAGATGGTTGCAGG + Intronic
984891418 4:184497478-184497500 GTCCATGTAAAGATGGAGGCAGG + Intergenic
985818163 5:2141937-2141959 GCGGATGAGCAGATGGAGGCAGG + Intergenic
987256675 5:16161320-16161342 GTTTATGAACACATGCAGGAAGG - Intronic
988667601 5:33346760-33346782 GTTGAAGACCAGATGGTTGCAGG - Intergenic
988819024 5:34862473-34862495 GTTGTTCAACAGTTGGAGGATGG + Intronic
990156613 5:52885157-52885179 GTTGCTGAACAGGTGGAAGGAGG - Intronic
990604554 5:57395760-57395782 GGCGCTGAACACATGGAGGCTGG - Intergenic
990820360 5:59832928-59832950 GTTGAAGCAGAGATGGGGGCCGG + Intronic
993862784 5:93156757-93156779 GTTCATGAGCTGAAGGAGGCTGG - Intergenic
995034081 5:107513699-107513721 GTTTCTGAACAGAAAGAGGCTGG + Intronic
995353195 5:111206070-111206092 GTTGAGGAAGAGATGGAAGCTGG + Intergenic
996451756 5:123633543-123633565 GTTGAAGATCAGATGGTTGCAGG - Intergenic
999556446 5:152747872-152747894 GTTGAAGATCAGATGGATGTAGG - Intergenic
1000982603 5:167832581-167832603 GTGGATGGATGGATGGAGGCAGG + Intronic
1001147557 5:169198037-169198059 GTTGATGCATAGATGGATGGTGG - Intronic
1003274228 6:4635070-4635092 GTTGCTGAAAAGAATGAGGCAGG + Intergenic
1003674094 6:8186933-8186955 GTTGAAGATCAGATGGTTGCAGG + Intergenic
1004057649 6:12156520-12156542 GTTGAAGATCAGATGGTTGCTGG + Intronic
1004743081 6:18482081-18482103 ATAGAGGTACAGATGGAGGCAGG - Intergenic
1004884417 6:20037669-20037691 GTGGATGAAGACATGGAGGCTGG + Intergenic
1005001123 6:21242997-21243019 ATTGATGACCAGATGGCAGCCGG - Intergenic
1005283140 6:24296177-24296199 GTCGAAGAACAGATGGAAGTAGG - Intronic
1005979779 6:30828121-30828143 CTGGGTCAACAGATGGAGGCAGG + Intergenic
1007189395 6:40000434-40000456 GTTGCAGAAAAGATGGAGGAGGG - Intergenic
1009349313 6:62653946-62653968 ATTGATGAACTGTTGGGGGCTGG + Intergenic
1014498785 6:122160581-122160603 GTTGAAGATCAGATGGTTGCAGG + Intergenic
1014578498 6:123104980-123105002 GTTGATGATCAGATAGTTGCAGG + Intergenic
1014819334 6:125969295-125969317 GTTGAAGATCAGATGGCTGCAGG + Intronic
1015266442 6:131295982-131296004 GTTGAGGGACAGAGAGAGGCTGG - Intergenic
1015633293 6:135252376-135252398 GATGAGGCACAGAGGGAGGCCGG - Intergenic
1015774154 6:136796485-136796507 GTTGAAGATCAGATGGCGGTAGG + Intergenic
1015800064 6:137051762-137051784 TTTAATGAACAAATGGAGGATGG + Intergenic
1016293130 6:142545295-142545317 TTTGATGTAGACATGGAGGCAGG - Intergenic
1016695310 6:146987263-146987285 GTTGAAGATCAGATGGTTGCAGG - Intergenic
1017038146 6:150285566-150285588 GCTGCTGAACACATGGAGGGTGG + Intergenic
1017612667 6:156207219-156207241 GTTGAAGATCAGATGGTGGTAGG - Intergenic
1017870467 6:158482336-158482358 GATGCTGAACAAATGAAGGCTGG - Intronic
1017926584 6:158915898-158915920 GAAAATGAAGAGATGGAGGCCGG + Intergenic
1019762139 7:2821038-2821060 GTTGATGAAAACATGGATGTAGG - Intronic
1019869403 7:3745016-3745038 GATGATCATCACATGGAGGCCGG - Intronic
1020212476 7:6166858-6166880 GAGGAGGAACAGCTGGAGGCTGG - Intronic
1020315762 7:6904376-6904398 GTTGATGGACAGAGAGAGGTTGG - Intergenic
1021074565 7:16286363-16286385 GCTCATGAACTTATGGAGGCTGG - Intronic
1021490208 7:21211326-21211348 GTTTAGGAACAGATAGAGGTAGG + Intergenic
1022823212 7:33981640-33981662 ATTCATGAACAAATGGATGCTGG + Intronic
1023530475 7:41148602-41148624 GTGAATAAACAGGTGGAGGCAGG + Intergenic
1023600552 7:41877820-41877842 GCTGCTCAAGAGATGGAGGCAGG - Intergenic
1024665693 7:51544735-51544757 GGTGAGGGACAGATGGTGGCTGG + Intergenic
1025823077 7:64989261-64989283 GTTGAAGATCAGATGGTTGCAGG - Intronic
1028104919 7:86865840-86865862 GGTGATGTGAAGATGGAGGCAGG - Intergenic
1030919057 7:115357304-115357326 ATTGATGAACATCTGGTGGCAGG + Intergenic
1032193412 7:129777110-129777132 GCTGGAGAACAGATGGAGCCAGG + Intergenic
1032204599 7:129850934-129850956 ATAGATGGACAGATGGATGCAGG + Intronic
1036836907 8:12079034-12079056 GTTTATGAACAGATGGATAAAGG + Intergenic
1036858699 8:12325280-12325302 GTTTATGAACAGATGGATAAAGG + Intergenic
1037920438 8:22801913-22801935 GTTGATGAACAGATTCTGGGTGG - Intronic
1038076132 8:24076965-24076987 GTTGAAGAACAGGTCCAGGCCGG - Intergenic
1038114503 8:24538178-24538200 GTTGAGGAACAGAATGAGGTAGG + Intergenic
1038521907 8:28241173-28241195 GTTGATGGACAGATTAAGTCGGG - Intergenic
1038671373 8:29585764-29585786 GGTGATGGGAAGATGGAGGCAGG + Intergenic
1039558586 8:38495117-38495139 GTTGGTGAACAGATTGAAGCCGG + Intergenic
1040692210 8:49952725-49952747 GTAGATGTACAGATAGATGCTGG + Intronic
1041307161 8:56473235-56473257 TTGGATGCACAGATGGAGGCCGG + Intergenic
1041727185 8:61029369-61029391 GGAGAAGAACAGAGGGAGGCGGG + Intergenic
1042225935 8:66514344-66514366 GTTTTTGAACAGATGGGGACAGG - Intronic
1043793532 8:84505128-84505150 GATGCTGAAAAGATGGAGGCAGG - Intronic
1044499518 8:92936459-92936481 GAGGATGAACAGAGGGAGGCAGG + Intronic
1046612428 8:116440851-116440873 GATTTTGAACAGCTGGAGGCTGG - Intergenic
1047306763 8:123658989-123659011 GATGATGAATTGATGGAGGAGGG - Intergenic
1048979783 8:139697083-139697105 GTGGGTGAACAGATGGATGGTGG + Intronic
1049350698 8:142163007-142163029 ATTGATGTATAGATGGAGGATGG + Intergenic
1049434189 8:142578879-142578901 TTTCATGAACAGAACGAGGCCGG + Intergenic
1049506501 8:143003249-143003271 GTTGAAGATCAGATGGTTGCAGG + Intergenic
1052094595 9:24369234-24369256 GGTGATGAACAGTTGGTGGGGGG + Intergenic
1052586578 9:30436851-30436873 GTTGAAGATCAGATGGTTGCAGG - Intergenic
1053477980 9:38395852-38395874 GTTGATGAACAGCTGGTTGTAGG - Exonic
1055044358 9:71910238-71910260 GTGGATGAAAAGATGGGGTCAGG - Intronic
1055865000 9:80802413-80802435 CTCACTGAACAGATGGAGGCAGG + Intergenic
1056640396 9:88365251-88365273 GTTGTTGTTCAGATGGAGTCTGG - Intergenic
1057028218 9:91752858-91752880 ATTGATGGACAGATGGAGGCTGG + Intronic
1057043359 9:91864047-91864069 GTTCAGGAAAAGATGCAGGCGGG + Intronic
1057846125 9:98525978-98526000 GTAGATTAACAGCTGGGGGCCGG + Intronic
1058157376 9:101530596-101530618 GATGGTGAACAGAAGGTGGCTGG + Intronic
1059929449 9:119246631-119246653 GCTGGTGAACAGCCGGAGGCAGG + Intronic
1062197738 9:135283672-135283694 TTTGATGAATAAATGAAGGCAGG + Intergenic
1062271238 9:135710426-135710448 GTTGATGGAGAAATGGAGGCCGG - Intronic
1062698310 9:137886482-137886504 AATGATGAACAGGTGGAGGGAGG - Intronic
1185747943 X:2586452-2586474 GCCGATGAACAGCTAGAGGCTGG - Intergenic
1185973185 X:4687105-4687127 GTTTATGACGAGATGCAGGCAGG - Intergenic
1186207698 X:7217223-7217245 GAGGTTGAACAGATGGAGGGGGG + Intergenic
1186290852 X:8096995-8097017 GTTGAAGGACTGATGGAGCCTGG - Intergenic
1186697237 X:12048776-12048798 GTTGAAGATCAGATGGCGGTAGG + Intergenic
1189678798 X:43492201-43492223 GTTGAAGATCAGATGGTTGCAGG - Intergenic
1190515318 X:51217931-51217953 GTTGAAGATCAGATGGACGTAGG + Intergenic
1190527559 X:51343262-51343284 GTTCATGAAATTATGGAGGCTGG + Intergenic
1191223610 X:58016810-58016832 TTTGGTGATCAGATGGAGGCAGG - Intergenic
1191747499 X:64505700-64505722 GTCAAAGATCAGATGGAGGCAGG - Intergenic
1192201462 X:69069099-69069121 GTTGATGGACAGGTGGTGGCTGG - Intergenic
1192232238 X:69273297-69273319 GCTGATGAAGAGATGGAGTCTGG - Intergenic
1193884501 X:86968500-86968522 GGTGATGATCAGATGAATGCAGG - Intergenic
1194406427 X:93501849-93501871 GTTGATGATCAGATGGTTGTAGG - Intergenic
1196497529 X:116339007-116339029 GTTGAAGATCAGATGGCTGCAGG - Intergenic
1199081041 X:143577150-143577172 ATTGATGCATAGATGGAGGGTGG + Intergenic
1199748071 X:150787965-150787987 GTTGAAGATCAGATGGCTGCAGG + Intronic
1201669169 Y:16497385-16497407 GTTGTTGTACAGATGGAAGGTGG - Intergenic
1201765624 Y:17571311-17571333 GGGGATGAACGGATGGAGGTAGG + Intergenic
1201835928 Y:18334678-18334700 GGGGATGAACGGATGGAGGTAGG - Intergenic
1202167230 Y:22002798-22002820 GTTGCTGGGCAGATGGAGGATGG + Intergenic
1202318985 Y:23612089-23612111 GTTGCTGGGCAGATGGAGGATGG + Intergenic
1202551784 Y:26057968-26057990 GTTGCTGGGCAGATGGAGGATGG - Intergenic