ID: 905402904

View in Genome Browser
Species Human (GRCh38)
Location 1:37716296-37716318
Sequence CTGCAGAAACAGCTGGGGTA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 302}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905402895_905402904 2 Left 905402895 1:37716271-37716293 CCTGCCAACACAGCCAGGGGCCC 0: 1
1: 0
2: 0
3: 24
4: 302
Right 905402904 1:37716296-37716318 CTGCAGAAACAGCTGGGGTAGGG 0: 1
1: 0
2: 1
3: 26
4: 302
905402896_905402904 -2 Left 905402896 1:37716275-37716297 CCAACACAGCCAGGGGCCCTTCT 0: 1
1: 0
2: 0
3: 23
4: 222
Right 905402904 1:37716296-37716318 CTGCAGAAACAGCTGGGGTAGGG 0: 1
1: 0
2: 1
3: 26
4: 302
905402891_905402904 9 Left 905402891 1:37716264-37716286 CCGAAGTCCTGCCAACACAGCCA 0: 1
1: 0
2: 1
3: 30
4: 411
Right 905402904 1:37716296-37716318 CTGCAGAAACAGCTGGGGTAGGG 0: 1
1: 0
2: 1
3: 26
4: 302
905402889_905402904 18 Left 905402889 1:37716255-37716277 CCCTGGACACCGAAGTCCTGCCA 0: 1
1: 0
2: 0
3: 5
4: 110
Right 905402904 1:37716296-37716318 CTGCAGAAACAGCTGGGGTAGGG 0: 1
1: 0
2: 1
3: 26
4: 302
905402890_905402904 17 Left 905402890 1:37716256-37716278 CCTGGACACCGAAGTCCTGCCAA 0: 1
1: 0
2: 0
3: 5
4: 115
Right 905402904 1:37716296-37716318 CTGCAGAAACAGCTGGGGTAGGG 0: 1
1: 0
2: 1
3: 26
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905402904 Original CRISPR CTGCAGAAACAGCTGGGGTA GGG Exonic
900284511 1:1892552-1892574 CAGCAGAAATAGCTGGGTTCAGG - Intergenic
900471254 1:2856149-2856171 CTGCAGGCACAGCCGGGGCAGGG - Intergenic
900615410 1:3563437-3563459 CTGGAGTCACAGCTGGGGCAGGG + Intronic
900925711 1:5704995-5705017 CATCAGCATCAGCTGGGGTATGG + Intergenic
901124300 1:6918233-6918255 CTCCAGAAGCAGCTGGTTTAGGG - Intronic
901173399 1:7280445-7280467 CTGCAGAAGCAGCTTGGCTCTGG + Intronic
902224503 1:14988233-14988255 GTGCAGACAGGGCTGGGGTAGGG - Intronic
903792497 1:25904710-25904732 CTGCACAATCAACTGGGATAAGG + Exonic
905402904 1:37716296-37716318 CTGCAGAAACAGCTGGGGTAGGG + Exonic
905682719 1:39885703-39885725 CTGCAGTCCCAGCTGGGGTGGGG - Intergenic
905827700 1:41038735-41038757 CTGCAGAAGGAGGTGGGATATGG - Intronic
905945357 1:41897193-41897215 CTGCAGAAACATCAGAGGTAAGG + Intronic
906074965 1:43045403-43045425 GTGTGGAAACAGATGGGGTATGG + Intergenic
906399805 1:45496584-45496606 CTGCTGAAACAGCTGGCTGAGGG - Exonic
907513570 1:54979757-54979779 TTCCAGAACCAGCTGGGGTCTGG - Intergenic
908389943 1:63675267-63675289 CTGCTGAAGGAGCTGGGGGAGGG + Intergenic
912252459 1:108025722-108025744 CTGCAGCCACAGCTGGAGCAAGG - Intergenic
913230511 1:116737045-116737067 CTGCAGATACAGATGGGGTCTGG + Intergenic
913308729 1:117462868-117462890 CTACAGATACATCTGGGATATGG + Intronic
914451643 1:147798069-147798091 CTGCAGTCACAGCTGGGCTCAGG + Intergenic
915440081 1:155940508-155940530 CTGCAGAAGGAGCTGAGGTGGGG - Intergenic
915732365 1:158062891-158062913 CTCCAGAAACTTCTGGGCTATGG - Intronic
915789912 1:158657471-158657493 ATGAAGAAGCAGCTGGGGTAAGG - Exonic
916573647 1:166048597-166048619 CTGCAGCATGAGCTGGGGCAAGG + Intergenic
916791648 1:168130340-168130362 TTGCTGAAACAGCTGGGAGAAGG + Intronic
919581199 1:199375582-199375604 CTACAGAAAAATCTGGGGGAAGG + Intergenic
919606226 1:199688105-199688127 CTGGCTAACCAGCTGGGGTAAGG - Intergenic
920271113 1:204764460-204764482 CTGCAGAACTGGGTGGGGTAAGG - Intergenic
920713221 1:208315399-208315421 CTGTAGAAGCAGATGGGGAAAGG + Intergenic
922194921 1:223351604-223351626 ATGCAGGAACAGCTGTGGAAAGG + Intronic
923314206 1:232763879-232763901 CTACAGAAACAGCAGGGGTTTGG - Intergenic
924300881 1:242636596-242636618 CTGCAGAGACTTCTGGGGTATGG - Intergenic
924486564 1:244489517-244489539 CTGAAGAGACAGCTGGAGTCAGG + Intronic
924601911 1:245498398-245498420 CTGGAGAGGCAGCTGGGTTAAGG + Intronic
924809754 1:247390445-247390467 CTGCAGCAGCAGCTGGAGTCGGG + Intergenic
1062860428 10:805700-805722 CTGCAGAAGCAGCCGGGGACAGG + Intergenic
1063114432 10:3063972-3063994 AGGCAGAAACAGCAGGGGAAGGG + Intergenic
1067344530 10:45427995-45428017 CTGCAGAAGCAGAGGGGGAAGGG - Intronic
1067455021 10:46413022-46413044 CAGCAGAAACAGCAGAGGTGGGG - Intergenic
1067632183 10:47971612-47971634 CAGCAGAAACAGCAGAGGTGGGG + Intergenic
1067816542 10:49481883-49481905 CTGCAGGAACCACTGGGGTGAGG - Intronic
1069411103 10:68154336-68154358 CTGCTGAAGCAGCTGGGGCCAGG - Intronic
1070496691 10:77030829-77030851 TTGTAGAATCAGCTTGGGTATGG - Intronic
1070677374 10:78421229-78421251 CTGCCGAGACAGCCGGGGGAGGG - Intergenic
1071324546 10:84499850-84499872 GTGCAGAGAGAGATGGGGTAGGG - Intronic
1072796697 10:98361520-98361542 CTGCTCAGAGAGCTGGGGTAAGG + Intergenic
1073291084 10:102413704-102413726 CTCCAGAAACAGCTGCTGTAAGG - Intronic
1073319192 10:102603986-102604008 CTGGGGAAACAGCTGGGCTGTGG + Intronic
1073332824 10:102681889-102681911 CAGCAGAAAGAGCTGTGGTTTGG + Intronic
1073535660 10:104274821-104274843 CTCCAGAAACAGCTGCGCTCTGG - Exonic
1073774139 10:106767265-106767287 CTTCAGTGACAGCTGGGGAATGG - Intronic
1074158579 10:110818744-110818766 CTGCAGGAACTGCTTGGGAAGGG + Intronic
1074385730 10:113015234-113015256 CTGCAGAGACAGCAGAGGAATGG - Intronic
1074666467 10:115731785-115731807 CTGAAGAAAAATGTGGGGTAGGG - Intronic
1079081393 11:17415723-17415745 CTGCACAAACAGCTGGGGCAAGG + Intronic
1079369904 11:19842665-19842687 CTCCAGGGACAGCTGGGGCAAGG - Intronic
1080322332 11:31025894-31025916 CAGCAGAAAGAACTGAGGTATGG + Intronic
1080690221 11:34550002-34550024 CTGCAGGAGCAGCTGGGGATTGG + Intergenic
1080871095 11:36237681-36237703 TTGCAGAAAGAGCTGGTGGAGGG + Intergenic
1081638987 11:44740052-44740074 CTGCAGAGACACCTATGGTAGGG + Intronic
1082009684 11:47441734-47441756 CTGCAGAGCCAGGTGGGGGATGG + Intronic
1082640004 11:55647823-55647845 ATGGAGAAATAGCTGGGATAAGG - Intergenic
1083953155 11:65967744-65967766 CTGCAGAAGCAGCTGGAGAAGGG + Exonic
1084294905 11:68206560-68206582 CTGCTCACACTGCTGGGGTAAGG - Intronic
1085024083 11:73226512-73226534 CTGCAGGAATAGCTTGGGTACGG - Intronic
1085884273 11:80504376-80504398 CTGAAGAAACAGCTGATCTATGG - Intergenic
1086605255 11:88687929-88687951 CTTCAGAAAAAGCTGTGTTAGGG - Intronic
1088172840 11:107017854-107017876 CGGCAGAAGCAGCCGGGGTCGGG + Exonic
1090408560 11:126492256-126492278 TTGGAGACACAGCTGGGGAAGGG + Intronic
1097276610 12:57817905-57817927 CTGCAGAAACCCCTTGGGTGTGG + Intronic
1100741517 12:97598491-97598513 CTGAAGAAAAACCTGGGGTTGGG + Intergenic
1101041883 12:100763634-100763656 CTGCAGGAGCAGCTGGTGTCTGG + Intronic
1102250707 12:111385522-111385544 CAGCAGAAAGAGCTGGAGAAAGG + Intergenic
1104427776 12:128692328-128692350 CTTCATAAGCAGCTGAGGTAAGG + Intronic
1105450168 13:20492576-20492598 TGGCAGAAACAGGTGGGGCAGGG - Intronic
1107108609 13:36673118-36673140 CAGCAGAACCAGATGGAGTAGGG + Intergenic
1107843179 13:44481265-44481287 CTGCAGAAAAAGCTTGGGGTGGG + Intronic
1107966165 13:45600087-45600109 CTGCAGACATAGCTGTGGTTGGG - Intronic
1108001309 13:45907810-45907832 CTGCAGAGACAGCAGAGGTCTGG + Intergenic
1108475554 13:50812595-50812617 CTGCAGACATAACTGTGGTAGGG - Intronic
1112769750 13:102782235-102782257 CTGTGGAAGCAGCTGGGGTGAGG + Intergenic
1114618811 14:24082595-24082617 CTGCAGCAGCAGCTGGGGGCTGG - Exonic
1114661588 14:24349356-24349378 CTCCACAAACAGCTGTGGTGTGG + Intergenic
1116706408 14:48307808-48307830 CTGCAGAAACATTTGGGGCTGGG + Intergenic
1118648753 14:67867745-67867767 GTCCAGAAACAGCTGGGGCTGGG - Intronic
1119193860 14:72702627-72702649 CTGCAGAACCATCTGGGGGATGG + Intronic
1119474069 14:74917105-74917127 CAGGAGAAGCAGCTGGAGTAAGG + Intronic
1120516209 14:85473702-85473724 CAGCAGAATCATATGGGGTAAGG + Intergenic
1120979128 14:90275570-90275592 CTGGAGAAGCAGCTGGGGTGGGG - Exonic
1121179518 14:91918255-91918277 ATGCAGAAACAGCTGGGTTTTGG - Intronic
1121413416 14:93763002-93763024 CAGCAGAACAAGCTGGGGTCGGG - Intronic
1122638602 14:103143159-103143181 CTGCAGAAACACTCTGGGTAAGG + Intergenic
1124107600 15:26754776-26754798 CTGCACACACCTCTGGGGTAAGG - Intronic
1125977768 15:43970750-43970772 CTTCAGAAATAGATGGGGTATGG - Intronic
1127099077 15:55546113-55546135 CTGCAGAAGCATCTGCAGTATGG - Exonic
1130181161 15:81629899-81629921 CTGAAGAAACAGCTGGGAAGAGG - Intergenic
1130801570 15:87269200-87269222 CTCCACAAATAGCTGGAGTATGG + Intergenic
1131951274 15:97683965-97683987 ATGCAGAAAAAGTTGGGGTGGGG + Intergenic
1133338352 16:5021005-5021027 CTGCAGTGGGAGCTGGGGTAGGG + Intergenic
1133460087 16:5979996-5980018 CTGCAGAAACTGCTGTGCTAGGG + Intergenic
1133723788 16:8519021-8519043 CTGCAGAAATAGCTTGAGGAAGG - Intergenic
1134270797 16:12731416-12731438 CAGCAGAGACTGCTGGGGCATGG + Intronic
1134282208 16:12827138-12827160 CTGAAGACTCAGCTGGGGAAAGG + Intergenic
1134908597 16:18003881-18003903 GTGCAGAAACTGCTGGAGTGCGG - Intergenic
1137467687 16:48725803-48725825 CTGCAGAAACTGCTGGGACCAGG + Intergenic
1138409126 16:56824020-56824042 CTGCAGAAACAGTCCTGGTAGGG - Intronic
1138432438 16:56977663-56977685 CTGCTGTAGCAGCTGGGCTAGGG - Intronic
1139360781 16:66398445-66398467 CTGCAGGACCAGCTGGAGTGTGG - Exonic
1139447461 16:67006666-67006688 CAGCAGAAGCAGCAGGAGTAGGG + Intronic
1139706950 16:68747343-68747365 CTGCAGAGGCAGCTGGGCCAGGG + Intronic
1141770968 16:86089472-86089494 CTGCACACGGAGCTGGGGTATGG - Intergenic
1143615302 17:8046009-8046031 CTGCAGATACTTCTGGGGTAGGG + Intronic
1144132741 17:12263849-12263871 CTGCTGCTACAACTGGGGTATGG + Intergenic
1145058822 17:19719753-19719775 CTGCAGACACAGCTAGACTAGGG - Intergenic
1145265457 17:21377644-21377666 GGGCAGAGACAGCTGGGGTGGGG + Intronic
1147243716 17:39107370-39107392 CTGCAGAGACAGCTGGGTCTTGG - Intronic
1147601861 17:41751662-41751684 CTGCAAAGACAGCTGGGAAATGG - Intergenic
1148188220 17:45660070-45660092 CTGCAGCAGCAGTTGGGCTAAGG - Intergenic
1148838060 17:50476826-50476848 CTGCTGAGGCAGCTGGGGGATGG + Intergenic
1150602365 17:66661902-66661924 CTGCAGAAAAAGCTGCCGCAGGG - Intronic
1151361714 17:73593113-73593135 CTGCAGCAGGAGCTGGGGTGGGG - Intronic
1151711925 17:75812020-75812042 CAACAAAAACAGTTGGGGTAAGG + Intronic
1151920226 17:77149044-77149066 CTGGAGAGACAGATGGGGAATGG - Intronic
1152190877 17:78886526-78886548 GTGCAGAAACAGCAGGAGCACGG + Intronic
1152823228 17:82447726-82447748 CTGTAGGAACAGCTGTGGTCAGG + Intronic
1154052543 18:10974720-10974742 CTGCAGATAGTGCTGAGGTAGGG - Intronic
1154218164 18:12431127-12431149 CTGCAGAGACACCAGGGGTCGGG - Intronic
1156488789 18:37484374-37484396 CTGAAAAAACAACTGGGGAATGG + Intronic
1157118240 18:44882641-44882663 CCTCAGCAACAGCTGGGGGAAGG - Intronic
1157430320 18:47619407-47619429 CTGCAGAAACAACAAGGGCACGG - Intergenic
1158152567 18:54388939-54388961 ATGCAGAAAGAGTTGGGGGAGGG + Intergenic
1158572940 18:58612113-58612135 CTGCAGACACTGCAGGGGAATGG + Intronic
1158782551 18:60668414-60668436 CTGCTGAAGCAGCTGGGATTTGG - Intergenic
1160165071 18:76503910-76503932 GTGCAGAAACTTCTGGGGTGTGG + Intergenic
1160657812 19:282299-282321 CTGCACATACAGCTGGAGTGGGG + Exonic
1163196271 19:15723304-15723326 TTTCAGACACAGCTGGGGTGGGG + Intergenic
1164220287 19:23187241-23187263 CAGCTGAAGGAGCTGGGGTAGGG - Intergenic
1165941038 19:39414978-39415000 CTGCAGGAGCTGCTGGGGTGTGG - Exonic
1166088981 19:40495881-40495903 CAGCAGAAAAAGCTGGGTTCTGG - Intronic
1166287159 19:41838322-41838344 GTGCAGAAAGAGCTGGGGGGAGG - Intronic
1166415035 19:42589166-42589188 CAGTAGAAACAGCGGGGGTTTGG - Intronic
1166738594 19:45100758-45100780 AAACAGAAACAGGTGGGGTAAGG + Intronic
1167173391 19:47848827-47848849 CAGAGGAAACAGCTGGGGGAAGG - Intergenic
1167641176 19:50682598-50682620 AAACAGAAACACCTGGGGTATGG + Intronic
1167744069 19:51340701-51340723 CTGAACCGACAGCTGGGGTAGGG + Exonic
927097676 2:19759990-19760012 CTGCAGAGGAAGCTGGTGTATGG - Intergenic
927930376 2:27039950-27039972 CCCAAGAAACAGCTGGGGAAAGG - Intronic
927945650 2:27133710-27133732 CTGCAGAAAGTGCTGTGGGAGGG + Exonic
928964289 2:36961903-36961925 CAGAAGGAACAGCTGGGGGAAGG - Intronic
933617228 2:84495008-84495030 CTGTGGAATCACCTGGGGTAGGG + Intergenic
933916004 2:86994211-86994233 CTTCAGAATCACCTGGAGTAAGG + Intronic
934006989 2:87775691-87775713 CTTCAGAATCACCTGGAGTAAGG - Intronic
934044422 2:88160784-88160806 CTGAAGAAACAGCTCGCCTAAGG + Intergenic
935195250 2:100810004-100810026 TGGGAGAAAGAGCTGGGGTAGGG + Intergenic
935312674 2:101801074-101801096 CAGCAGCAGCAGCTGGGGAAAGG - Intronic
935770632 2:106416597-106416619 CTTCAGAATCACCTGGAGTAAGG - Intronic
935909454 2:107879338-107879360 CTTCAGAATCACCTGGAGTAAGG + Intronic
935967585 2:108496340-108496362 CTTCAGAATCACCTGGAGTAAGG + Intronic
936131231 2:109844474-109844496 CTTCAGAATCACCTGGAGTAAGG + Intronic
936213466 2:110527011-110527033 CTTCAGAATCACCTGGAGTAAGG - Intronic
936422604 2:112381570-112381592 CTTCAGAATCACCTGGAGTAAGG - Intronic
937053145 2:118908496-118908518 CTGAAGATCCAGCTGGGGAAAGG + Intergenic
937214536 2:120303290-120303312 TTGGAGGAACAGCTGGGGTGGGG - Intergenic
937802052 2:126091687-126091709 CTCCATAAAGTGCTGGGGTATGG - Intergenic
938099833 2:128491135-128491157 CTGCACAAACCCCTGGGCTAAGG - Intergenic
938583299 2:132667693-132667715 CTGATAAGACAGCTGGGGTAGGG + Intronic
939732980 2:145808359-145808381 CAGCAGAAACAGCAGGGAGAGGG - Intergenic
945052412 2:205836575-205836597 CAGCAGAAGCAGCGGGGGTGGGG - Intergenic
947820252 2:233064128-233064150 CTGCAGGAGCAGCTGGGGCCCGG + Intronic
947875007 2:233462008-233462030 CTGCAGAGACTGCTGCAGTAAGG - Intronic
948356841 2:237384847-237384869 CTGGAGAAGCAGCTGCTGTAGGG - Intronic
1168951933 20:1808304-1808326 AGGCAGAAAGATCTGGGGTAGGG + Intergenic
1170052927 20:12166503-12166525 CTGCAGAAACTGCTGGCCAATGG - Intergenic
1171199997 20:23233171-23233193 CAGCAGTCACAGCTGGGGTTGGG - Intergenic
1171429961 20:25076832-25076854 TTGCACAAACAGGTGGGGGAGGG - Intronic
1172220302 20:33269475-33269497 GAGCAGAAAGGGCTGGGGTAAGG + Intergenic
1172261331 20:33568495-33568517 CTGCTGGAAGAGCTGGGGGATGG + Intronic
1172910997 20:38408709-38408731 CTGGAGAAACAGCTGGGCTTTGG - Intergenic
1173888648 20:46484830-46484852 CCTAAGAAACAGCTGGGGAATGG + Intergenic
1173974254 20:47175167-47175189 ATGCAGGAACAGCTGGGTTGGGG - Intronic
1176672140 21:9744859-9744881 GTGCACAAACAGCTGGGGGGGGG + Intergenic
1177905370 21:26966615-26966637 CTCCAGAAAGAGGTGGGGTGGGG + Intergenic
1177937073 21:27362245-27362267 CTGCTGAAACACTTGGGGTTAGG - Intergenic
1178398521 21:32263776-32263798 CTGCAAACCCAGCTGGGGTCGGG + Intergenic
1178781278 21:35605030-35605052 CTGAGGAAACAGATGGGATAAGG - Intronic
1179154483 21:38838257-38838279 CTGCAGAGACAGTTGGAGCATGG - Intergenic
1179400619 21:41079864-41079886 ATGCTGAAACAGCTGGTGTCTGG - Intergenic
1180083954 21:45499241-45499263 CTGCCGACACAGCTCGGGTCTGG - Intronic
1180085296 21:45505467-45505489 CTGCAGAACCAGCCAGGGCACGG - Intronic
1181848920 22:25735852-25735874 CTGCAGGAACAGCTGGCTCAAGG - Intergenic
1181872325 22:25909847-25909869 TGGCAGAAAGAGCTGGGGTCAGG + Intronic
1182066640 22:27435849-27435871 CTGCAAATACAGCCGGGGTTGGG - Intergenic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1182842197 22:33400379-33400401 CTGCAGAGCCATCTGGGGGAGGG + Intronic
1183554285 22:38513129-38513151 CTGCAGAAACAGCCTGGGCATGG + Intergenic
1183686899 22:39366309-39366331 CTGCAGACACAGCCGACGTAGGG - Intronic
1183715460 22:39530754-39530776 CAACAAAAACAGCTGGAGTAGGG + Intronic
1184643557 22:45884554-45884576 CTGCAGGGACAGCTTGGGAAGGG + Intergenic
1184761404 22:46546855-46546877 CTGCTGAAACTGCTGGAGTCAGG - Intergenic
1184834291 22:47012019-47012041 GTGCAGAATCAGCTGGGGGCGGG - Intronic
1185101205 22:48841811-48841833 CTGCAGATGGAGCTGGGGGATGG + Intronic
949397203 3:3627321-3627343 CTGCAGCAACAGCAGAGGGAGGG - Intergenic
949874659 3:8618367-8618389 ATGCAGGAACAGCAGGGGTTAGG - Intergenic
950234687 3:11308482-11308504 CTGCAGACTCTGCTGGGGAACGG - Intronic
950434950 3:12973904-12973926 GTGCAGAAGGAGCTGGGGAAAGG - Intronic
950443605 3:13023573-13023595 CTGCAGAAACAGGGAGGGTGGGG + Intronic
953878476 3:46679527-46679549 CTGAAGAAGCCGCTGGGGTGAGG - Intronic
955733770 3:62015303-62015325 CTGCTGAAACAGCAGGAGAAAGG + Intronic
961802655 3:129464512-129464534 AGGCAGCAACAGCTGGGATATGG - Intronic
962201323 3:133403321-133403343 GTGGAGAAACAGGAGGGGTAAGG - Intronic
963025445 3:140914248-140914270 ATGCAGACAGAGCAGGGGTAGGG - Intergenic
963564213 3:146907358-146907380 CTGCACAAACACCCGTGGTAAGG + Intergenic
966888064 3:184387504-184387526 CTGCAGACCCCGCTGGGTTATGG - Intronic
967052227 3:185795343-185795365 CTGGAGAAACAAATGTGGTATGG - Intronic
968264543 3:197352676-197352698 CTGCAGACACAGCGGGGGCAGGG - Intergenic
969176258 4:5401076-5401098 CTGCAGAAACAAGAGGGGAATGG + Intronic
975371967 4:73599508-73599530 CTGGGAAAACAGCTGTGGTAAGG + Intronic
976816479 4:89153568-89153590 CTACAGAAAGAGCAGGGGTTAGG - Intergenic
977136496 4:93311198-93311220 CTGAAGAGACAGCTGGAGTCAGG + Intronic
977475292 4:97499786-97499808 CAGCAGAAACAGCTAGTGCAAGG + Intronic
978040720 4:104057791-104057813 CTCCAGAGACAGCTGAGGTTTGG + Intergenic
978309966 4:107376615-107376637 CCTCTGAAACAGCAGGGGTAAGG - Intergenic
978383896 4:108160900-108160922 CTGGAAAAACACCTGGGGTGGGG - Intronic
979028238 4:115604883-115604905 CCCCAGAAACTGATGGGGTAAGG - Intergenic
982465271 4:155722780-155722802 ATGAAGAAACAGTTTGGGTAAGG + Intronic
982713155 4:158779021-158779043 CTGAAGAAATAGCAGTGGTAGGG + Intronic
982743940 4:159086830-159086852 CTGGAAAAACAGCTGGTGTGTGG + Intergenic
985402596 4:189606989-189607011 GTGCACAAACAGCTGGGGGGGGG - Intergenic
985427065 4:189841348-189841370 CTGCATAAACACCAGGGGAAAGG - Intergenic
985752891 5:1692460-1692482 CTGCAGCAACATCTAGGGTAGGG + Intergenic
985922235 5:2986421-2986443 CTGCAGACACTGCTGGGCTGGGG - Intergenic
986788895 5:11141668-11141690 GTGCAGACACAGCTGGCCTAAGG - Intronic
986820188 5:11458298-11458320 TTTCATAAACAGCTGAGGTATGG + Intronic
987081204 5:14427184-14427206 CTGCAGAAAGGGGTGGGGTGAGG - Intronic
991325870 5:65431736-65431758 CTGCAGAAACAGCAGGTTTGAGG + Intronic
991997316 5:72400790-72400812 CTGCAGGAATAACTGGGGGAAGG - Intergenic
992342886 5:75844302-75844324 CTGCTGAAAGAGCTGGGGGCTGG - Intergenic
992676329 5:79109802-79109824 CTGCAACAGCAGCTGGGGAAAGG + Intronic
995447191 5:112258302-112258324 CTGCAGCTACATTTGGGGTATGG - Intronic
996485546 5:124029589-124029611 CTGCAGAATCAGGTGGGTGAAGG - Intergenic
997434441 5:133864311-133864333 CTGCAGAGACTTCTGGTGTATGG + Intergenic
998934158 5:147216478-147216500 TTCCAGACACAACTGGGGTATGG - Intergenic
999991004 5:157049778-157049800 ATGCAGAAGGAGCTGGGGTCAGG - Intronic
1001046848 5:168380313-168380335 ATACAGAATCAGCTGGGGCATGG + Intronic
1001673106 5:173490852-173490874 CCCCAGAGACAGCTGGGGCATGG + Intergenic
1002560268 5:180076917-180076939 CTGCAGCCACAGCTGGGGGTGGG - Intergenic
1002890254 6:1325859-1325881 CAGCAGAATGAGCTGGGGTGGGG - Intergenic
1003181523 6:3795964-3795986 CTGCAGCCACAGCTGGAGTCTGG + Intergenic
1004290292 6:14360857-14360879 CTCAAGAGACAGCTGCGGTAGGG - Intergenic
1004659529 6:17697745-17697767 ACTCAGAAACAGCTGGGGTGGGG + Intronic
1004659537 6:17697789-17697811 ACTCAGAAACAGCTGGGGTGGGG + Intronic
1004679009 6:17874223-17874245 CTGCAGAGACAGAAGGGGAAAGG - Intronic
1006798239 6:36744191-36744213 CTGGGGAAACATCTGGGGTGGGG + Intronic
1007183941 6:39951451-39951473 CAGGAGAAACAGCAGGGATATGG - Intergenic
1007211164 6:40194405-40194427 CAGCAGAAACACCTGGGGAAGGG + Intergenic
1008438387 6:51503162-51503184 CTGCTGAAACAGTAGGGGTGAGG + Intergenic
1008475200 6:51928779-51928801 ATGCAGAGACAGCCAGGGTAAGG + Intronic
1010909353 6:81535130-81535152 AAGCAGAAACATCAGGGGTAAGG + Intronic
1013256110 6:108387402-108387424 CTGCACATACACCTGGGCTATGG + Intronic
1015042420 6:128738290-128738312 CTACAGAAAAAGGTGGGGGAAGG + Intergenic
1015804204 6:137092150-137092172 CTGCAGCAACAACAGGGGCAAGG - Intergenic
1017192195 6:151666596-151666618 CTGCAGAAACAGATGTGCTAAGG - Intronic
1018572305 6:165224470-165224492 CTGCAGATATAGCTGGAGAAGGG - Intergenic
1019224714 6:170500401-170500423 TTTCAGAAACAGCAGGGGCAGGG - Intergenic
1019862452 7:3672245-3672267 CTACAGAAACAGGATGGGTATGG - Intronic
1020901414 7:14008264-14008286 CTGCTGAACCCCCTGGGGTATGG - Intergenic
1023048043 7:36228596-36228618 CTGCAGACACAGCTGGGGCCAGG + Intronic
1023905833 7:44521119-44521141 CTGCAGAGAAAGCAGGGGTCTGG + Intronic
1024418375 7:49134674-49134696 ATGCAGAAACAACAGGGGTTAGG - Intergenic
1024702413 7:51918468-51918490 CTGAATAAACAGCTGGTGTTTGG - Intergenic
1026111926 7:67465314-67465336 CAGCAGCAACAGCTGGAGCATGG + Intergenic
1026226905 7:68450311-68450333 CTCCAGAAACAACTGGGCTAAGG - Intergenic
1026262718 7:68769695-68769717 CTGCAAAGACAGCTGTGTTAGGG + Intergenic
1029441381 7:100588648-100588670 CAGGAGAAACAGCAGGGGTCAGG - Intronic
1032119655 7:129146562-129146584 CTGCTGCTATAGCTGGGGTATGG + Intronic
1032418648 7:131759490-131759512 CTGGAGAAAGAGCAGGGGAAAGG - Intergenic
1032451385 7:132034893-132034915 CTGCAGAGCCAGGTGGGGTTGGG - Intergenic
1032980295 7:137274206-137274228 CTCTAGGCACAGCTGGGGTAAGG - Intronic
1033242485 7:139691650-139691672 CAGCAAAACCAGCTGGGATAAGG + Intronic
1034056262 7:148038333-148038355 CTGCGGAAGCAGCTTGGGAAAGG - Intronic
1034234626 7:149557100-149557122 CCCCAGAAACAGATGGGGAATGG + Intergenic
1034239406 7:149598332-149598354 CCCCAGAAACAGATGGGGAATGG + Intergenic
1034352038 7:150422584-150422606 CTTCAGAATCATCTGGGGTGTGG + Intergenic
1034441623 7:151088592-151088614 CTCCAGAAGGAGCTGGGGGAAGG - Intronic
1034918858 7:155062369-155062391 CTGGAGAAAGAGCTAGGGAAGGG + Intergenic
1035049530 7:155990509-155990531 CTGGAGGAGCAGCTGGGGAAGGG + Intergenic
1038848547 8:31252206-31252228 CTGCAGACACACATAGGGTACGG - Intergenic
1040621370 8:49096303-49096325 CTGCAGGAACAGTAGGGGCAAGG - Intergenic
1040879312 8:52188376-52188398 CAGCAGAAACAGCAGGTGCAAGG + Intronic
1041887744 8:62831164-62831186 CTGTAGAGAATGCTGGGGTAGGG - Intronic
1041928552 8:63263675-63263697 CAGCAGAAGCAGCTGGTGGATGG + Intergenic
1042271961 8:66963322-66963344 CTGCAGAAACCGCTGCGGTTTGG - Intergenic
1042704600 8:71652701-71652723 ATGCAGAAACAGCTCAGGGAAGG - Intergenic
1042904141 8:73756278-73756300 CTGCAGATGTTGCTGGGGTAGGG + Intronic
1042904287 8:73757395-73757417 CTGCAGATGATGCTGGGGTAGGG - Intronic
1043922629 8:86001266-86001288 CTGCACAACCAGCCTGGGTAAGG - Intronic
1046782855 8:118233799-118233821 CTGGTAAAACAGCTGGGTTAGGG + Intronic
1047016767 8:120731785-120731807 ATACAGCAACAGCTGGGGTCTGG - Intronic
1047889640 8:129293704-129293726 ATGGATAAAAAGCTGGGGTAGGG + Intergenic
1048787363 8:138064175-138064197 CTGCAGAAGGGGCTGGGTTATGG - Intergenic
1049531397 8:143157276-143157298 GGGCAGAGACAGCTGGGGTGGGG + Intergenic
1050054661 9:1639343-1639365 CTGCAGAAATACTTGGGGTGGGG - Intergenic
1051507959 9:17846201-17846223 CTGCAGAAAGAGAGGGGGAAAGG - Intergenic
1051845586 9:21448191-21448213 CTGAAGAAAAAGCTGGTGGAAGG - Intergenic
1055187675 9:73475209-73475231 CTGCACGAACTGCTGGGCTATGG - Intergenic
1056276980 9:85002970-85002992 TTGGAGAAACAGTTGGGGGACGG + Intronic
1056706527 9:88956597-88956619 GTGCAGAGACACCTGGGGGAAGG - Intergenic
1059070771 9:111133653-111133675 CTGCTGAAGCAGCTGGATTATGG + Intergenic
1059153155 9:111967124-111967146 CTGCAGGATCTGCTGGGGGAGGG - Intergenic
1060110989 9:120906050-120906072 CTGGGGAAACAGGTGGGGCAGGG - Intronic
1060766614 9:126298718-126298740 CAGTAGAAACAGCTGGAGCAAGG - Intergenic
1061075043 9:128336046-128336068 CTGCAGAGACTGGTGAGGTATGG - Intergenic
1061379563 9:130245934-130245956 CTCCAGAAAAAGCGGGGGCAAGG - Intergenic
1061846329 9:133390550-133390572 CTGCAGAACCAGGTGGGGCAGGG + Intronic
1185877406 X:3712593-3712615 CTGCAGGAGCAGCTGGGCTGTGG - Intronic
1185893963 X:3842848-3842870 CTGCAGGAGCAGCTGGGCTCCGG - Intronic
1185899080 X:3881272-3881294 CTGCAGGAGCAGCTGGGCTCCGG - Intergenic
1185904197 X:3919701-3919723 CTGCAGGAGCAGCTGGGCTCCGG - Intergenic
1190087582 X:47409241-47409263 CTGCATGAACAGCTGGGATGAGG - Intronic
1190369951 X:49730975-49730997 CTAGAGATACAGCTGGGGCAGGG + Intergenic
1192443597 X:71193560-71193582 GGGCAGGAACAGCTGGGGCAGGG - Intergenic
1194212065 X:91082035-91082057 CCACAGAGACAGCTGGGGTCAGG + Intergenic
1194740314 X:97564722-97564744 TTGCAGAAACAAATGGGGAAAGG + Intronic
1196027059 X:111052178-111052200 CTCCAGAAACTGCTGAGGGAGGG + Intronic
1199193342 X:144997618-144997640 CTGTGGAAGCAGCTGGGGTGAGG + Intergenic
1199533085 X:148871504-148871526 TTACAGAAGAAGCTGGGGTAAGG - Intronic
1199947806 X:152681844-152681866 CTGCGGAAACAGCAGGGGCAAGG - Intergenic
1199961873 X:152786610-152786632 CTGCGGAAACAGCAGGGGCAAGG + Intergenic
1200787892 Y:7274937-7274959 CTGCAGGAGCAGCTGGGCTCCGG + Intergenic
1201868068 Y:18676256-18676278 GTGTAGAAACAGCAGGTGTATGG - Intergenic