ID: 905404123

View in Genome Browser
Species Human (GRCh38)
Location 1:37721830-37721852
Sequence AGCTCCCCAAACCGCCCTGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 74}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905404120_905404123 4 Left 905404120 1:37721803-37721825 CCGGGGAGCTGCAAGCAGCCACA 0: 1
1: 0
2: 1
3: 57
4: 325
Right 905404123 1:37721830-37721852 AGCTCCCCAAACCGCCCTGTGGG 0: 1
1: 0
2: 0
3: 6
4: 74
905404119_905404123 12 Left 905404119 1:37721795-37721817 CCTGGCGACCGGGGAGCTGCAAG 0: 1
1: 0
2: 0
3: 12
4: 126
Right 905404123 1:37721830-37721852 AGCTCCCCAAACCGCCCTGTGGG 0: 1
1: 0
2: 0
3: 6
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905404123 Original CRISPR AGCTCCCCAAACCGCCCTGT GGG Exonic
900437359 1:2637520-2637542 AGCTCCCCCAACAACACTGTGGG - Intronic
902142785 1:14370474-14370496 CCCTCCCCAAACCACCCTCTTGG - Intergenic
902396140 1:16133353-16133375 ACCTCCCCAAACTCTCCTGTGGG + Exonic
905404123 1:37721830-37721852 AGCTCCCCAAACCGCCCTGTGGG + Exonic
905971930 1:42148215-42148237 AAGTCACCAAACTGCCCTGTGGG + Intergenic
915012206 1:152698176-152698198 AGCTCCCAAGACCTCCCTCTGGG - Intergenic
915835660 1:159172999-159173021 TCCTCCCCCCACCGCCCTGTCGG + Intronic
916198385 1:162246772-162246794 AGCTCCCCAATCTGTGCTGTGGG + Intronic
917510169 1:175663169-175663191 AGCTCCCCAAGCCGCCACGCTGG + Intronic
917536840 1:175880429-175880451 AGCTCTCCCAACCTCCCTGCAGG - Intergenic
918124166 1:181568210-181568232 AGCTCTCCAGACTCCCCTGTGGG - Intronic
920670276 1:207998840-207998862 AGCCCCACAGACCTCCCTGTGGG + Intergenic
923299617 1:232629753-232629775 AGCCCCCCAAAGCGCCCCGAAGG + Intergenic
924933627 1:248750107-248750129 AGTTACTCAAAACGCCCTGTGGG + Intronic
1065549995 10:26860664-26860686 AGTTCCCCACCCCGCCCAGTGGG + Intronic
1067850348 10:49750433-49750455 ACCTCCACAGACCTCCCTGTTGG + Intronic
1071140052 10:82498918-82498940 AGCTTCCCAAACTGAGCTGTGGG - Intronic
1076827906 10:132979230-132979252 AGCTCCTCACACGGCCCTGAAGG - Intergenic
1078085797 11:8232429-8232451 ATTTCCCCACACCTCCCTGTAGG - Intronic
1078101815 11:8334510-8334532 AGCTCCCCAACTTGCTCTGTTGG + Intergenic
1078406053 11:11070935-11070957 GGCTCCCCAAAGAGCCCTGTGGG + Intergenic
1078532477 11:12147934-12147956 AGCTCACCAAACCTGGCTGTCGG - Intronic
1080422834 11:32126898-32126920 GGCTCCCCACACGGCCCTGCTGG + Intergenic
1080645655 11:34185981-34186003 AACCCCCCAAACCACCCTGGGGG + Intronic
1083615165 11:64022465-64022487 CGCTCCCCTAAGCCCCCTGTGGG - Intronic
1085470291 11:76753246-76753268 AGCTCCCCAACCCCACCTCTAGG + Intergenic
1090990321 11:131811426-131811448 AGCTCCTCAAGCCTGCCTGTTGG - Intronic
1104953051 12:132451060-132451082 AGCTCCCCAAACGGGCCTTGGGG - Intergenic
1118902389 14:69997468-69997490 AGCTCACCAAACCTCTCAGTAGG - Intronic
1202859512 14_GL000225v1_random:72602-72624 AGCTCACGAAAGCCCCCTGTGGG + Intergenic
1125761894 15:42102472-42102494 CGCTCCCCACTCCGCCCTGTTGG + Intergenic
1130520401 15:84657271-84657293 AGCTCCCCACACCTCCCTGAGGG - Exonic
1131471852 15:92704479-92704501 AGCTCTTCAACCTGCCCTGTTGG + Intronic
1134512431 16:14859207-14859229 AGCTCCCTGCACCTCCCTGTTGG - Intronic
1134700071 16:16257708-16257730 AGCTCCCTGCACCTCCCTGTTGG - Intronic
1134971755 16:18536952-18536974 AGCTCCCTGCACCTCCCTGTTGG + Intronic
1138774457 16:59704655-59704677 AGAACCCCAAACTGACCTGTTGG + Intergenic
1144448561 17:15354990-15355012 AGCTCCCCAATCCCCCATCTGGG + Intergenic
1162101814 19:8343339-8343361 GGCTCTCCAAGCCGCCCAGTGGG + Intronic
1164880226 19:31726681-31726703 ACCTCCCCACACCTCCCTGCTGG + Intergenic
1165090988 19:33388359-33388381 AGCTGCCCAGACAGGCCTGTGGG + Intronic
1166783892 19:45356439-45356461 AGCTGCCCAGACCCCACTGTGGG + Intronic
1166837613 19:45677155-45677177 GGCTCCCCCAACTGCCCTGCTGG + Intronic
1166885229 19:45956373-45956395 ACCTCCCCAAAAGCCCCTGTGGG - Intronic
1168535723 19:57167768-57167790 GGCTCCCCCAACCCCCTTGTGGG + Intergenic
936039974 2:109142376-109142398 AGGACCCCAAAGCACCCTGTGGG + Intronic
937292644 2:120790828-120790850 AGCTCCTCAGACCTGCCTGTGGG - Intronic
938147426 2:128848422-128848444 AGCTCTCCAAACTGTCCTTTTGG - Intergenic
938634390 2:133207311-133207333 AGCCCCCAAAAGAGCCCTGTAGG - Intronic
1181037151 22:20175213-20175235 AGCTGCCCACACCGCCCTGCTGG + Intergenic
1182731392 22:32498180-32498202 AGCATCACAAACCGCCCTTTCGG - Exonic
1184822207 22:46917849-46917871 AGCGCCATAAACCTCCCTGTGGG - Intronic
956187728 3:66578590-66578612 AGCTCACCAACCTGCTCTGTTGG - Intergenic
957084852 3:75669536-75669558 GGCTCCCGAAAGCCCCCTGTGGG - Intergenic
961046956 3:123715528-123715550 AGCTTTCCAAAACGCCATGTTGG - Intronic
964063635 3:152555732-152555754 AGCTCCCCAAACCCACGTGAAGG + Intergenic
965611885 3:170553073-170553095 AGCTCCCCAAAGTGCCTTTTGGG + Intronic
967184019 3:186930399-186930421 CGCGCCCCAAACCGGCCTGGAGG - Intergenic
969331088 4:6473701-6473723 AGCTCCCCAAACTGCAGTGGAGG + Intronic
972922817 4:43965303-43965325 AGCTCCCTTAAGCACCCTGTGGG + Intergenic
985530239 5:429739-429761 AGCTCCCCAGCCAGCCCAGTGGG + Intronic
989122724 5:38020455-38020477 AGCTCCCCCAACCGAGCTGGGGG - Intergenic
995679932 5:114704733-114704755 AGCCCCCCACACTGCACTGTGGG - Intergenic
997251606 5:132392910-132392932 GGCTCCCTAAACCACTCTGTAGG - Intronic
997376577 5:133401782-133401804 GACTCCCCCAGCCGCCCTGTGGG + Intronic
1003038013 6:2661980-2662002 CGCTCTCCAAACAGCACTGTGGG - Intergenic
1005294660 6:24413457-24413479 AGCTCCCCAAACCCACCTAAGGG + Intronic
1012968278 6:105699238-105699260 AGCTTCCCAACTGGCCCTGTTGG + Intergenic
1019152918 6:170020868-170020890 TTCTCCCCAAAGTGCCCTGTAGG + Intergenic
1022957574 7:35395559-35395581 AGCTCCCAAAACCACCTTCTTGG - Intergenic
1029191307 7:98774227-98774249 AGGCCCCCGATCCGCCCTGTTGG + Intergenic
1032339922 7:131061372-131061394 AACACCTGAAACCGCCCTGTTGG - Intergenic
1038319817 8:26515378-26515400 CGCTCCCCAAACCGCTATGTGGG + Intronic
1041787672 8:61653122-61653144 GACTTCCCAAACCTCCCTGTGGG - Intronic
1046805878 8:118478402-118478424 GGCTCTCCACACAGCCCTGTTGG - Intronic
1049293668 8:141818055-141818077 AGCTCCCCTGACCGACCTGTGGG - Intergenic
1052091488 9:24333951-24333973 AGCTCCTCAAAAGGCCCTTTAGG + Intergenic
1055569439 9:77601676-77601698 AGCTCACCAAACTGGCCTATTGG + Intronic
1055769548 9:79702731-79702753 AGGTCCCCAGCCCGCCCAGTGGG + Intronic
1060544080 9:124450337-124450359 CGCTCCCCACCCCGCCCTCTTGG - Intergenic
1062481644 9:136755145-136755167 AGCTCGGCACACCGCCCTGCAGG + Exonic