ID: 905405368

View in Genome Browser
Species Human (GRCh38)
Location 1:37728826-37728848
Sequence AGGGTCTGGGTGGGGATAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 595
Summary {0: 1, 1: 2, 2: 6, 3: 50, 4: 536}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905405355_905405368 5 Left 905405355 1:37728798-37728820 CCCAGGGTTCCAGAGGCAAAGAG 0: 1
1: 0
2: 4
3: 25
4: 269
Right 905405368 1:37728826-37728848 AGGGTCTGGGTGGGGATAGAGGG 0: 1
1: 2
2: 6
3: 50
4: 536
905405360_905405368 -4 Left 905405360 1:37728807-37728829 CCAGAGGCAAAGAGGGCTGAGGG 0: 1
1: 0
2: 2
3: 36
4: 349
Right 905405368 1:37728826-37728848 AGGGTCTGGGTGGGGATAGAGGG 0: 1
1: 2
2: 6
3: 50
4: 536
905405356_905405368 4 Left 905405356 1:37728799-37728821 CCAGGGTTCCAGAGGCAAAGAGG 0: 1
1: 0
2: 6
3: 34
4: 261
Right 905405368 1:37728826-37728848 AGGGTCTGGGTGGGGATAGAGGG 0: 1
1: 2
2: 6
3: 50
4: 536

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905405368 Original CRISPR AGGGTCTGGGTGGGGATAGA GGG Intronic
900116351 1:1029302-1029324 AGTGTATGGGTGGGGGTTGAGGG + Intronic
900387970 1:2419287-2419309 AGGGGCTGGCAGGGGATAGATGG - Intergenic
900397975 1:2461032-2461054 AGGGCCTGGGTGGGGCCAGGTGG + Intronic
900660241 1:3778433-3778455 AAGATCTGGGTGGGGACAGGAGG + Intergenic
900696807 1:4017102-4017124 AGAGTCAGGGTGGGGAGAAACGG + Intergenic
900871159 1:5304364-5304386 AGAGTCAGGGTGGGGCTGGATGG - Intergenic
901351380 1:8600013-8600035 GGGGGCTGGGTGGAGATAAATGG + Intronic
901843081 1:11965741-11965763 AGGATTTGGGTAGGGAGAGAAGG + Intronic
902106713 1:14043070-14043092 AAGGACTGGGTGGGGATTGAAGG - Intergenic
902160686 1:14527952-14527974 GGTGCCTGGGCGGGGATAGAAGG + Intergenic
903000660 1:20263177-20263199 AGAATGTGGGTGGGGAAAGAGGG + Intergenic
903015358 1:20358106-20358128 AGGGACTGGCTGGGGAAACATGG - Intergenic
903545708 1:24122109-24122131 AGGGTCAGGGTGGGAAAAGAAGG + Intronic
903759654 1:25689057-25689079 AGGCACTGGGTGGGGAAAGCCGG + Intronic
904600230 1:31668889-31668911 AGGGGCTGGGTGGGGACCGCCGG - Intronic
904630855 1:31841001-31841023 AGGCTCAGGGTTGGGAAAGAGGG + Intergenic
904927082 1:34057724-34057746 AGAGTCTGGGTGGGCAGAGCTGG - Intronic
904939167 1:34152882-34152904 AGGGGCTGGGGAGGGAGAGATGG - Intronic
905405368 1:37728826-37728848 AGGGTCTGGGTGGGGATAGAGGG + Intronic
905586436 1:39122957-39122979 GGGGTCTGGGAGGGGAGAGGAGG + Intronic
906129979 1:43450278-43450300 AGGGCATGGGTGGGGATAGGAGG - Intronic
906882804 1:49610876-49610898 GGGGTCTGGCTGGAAATAGATGG + Intronic
906964078 1:50439599-50439621 GGGGTGTGGGTGGGGTTTGAGGG - Exonic
907033230 1:51193202-51193224 AGAGGCTGGGTGGGGGTAGGAGG - Intergenic
907119752 1:51998103-51998125 AGGGTTGGGGTGGGGAGGGAGGG - Intergenic
910100407 1:83569414-83569436 AGGGAGTGGGTGGGGAGACAAGG - Intergenic
910106661 1:83638514-83638536 AGGGTATGGGTGTGGAGGGAAGG - Intergenic
911179042 1:94844778-94844800 AGTGGCTGGATGGGGATGGAGGG + Intronic
911598350 1:99822233-99822255 AGGATCTGTGTGGGGGTAGTGGG - Intergenic
911895798 1:103433466-103433488 GGGGTGAGGGTGGGGATAGAAGG - Intergenic
912430440 1:109625821-109625843 AGGGTCTGGAAGGGTATGGAGGG - Intronic
913063001 1:115225077-115225099 AGGCTTTGGGTGGGTATTGATGG + Intergenic
913113744 1:115678504-115678526 TGGGACAGAGTGGGGATAGATGG + Intronic
913126386 1:115794101-115794123 AAAGTCTGGCTGAGGATAGAGGG + Intergenic
914213618 1:145604776-145604798 AGGGGCTGGTGGGGGATAGTCGG + Intergenic
914754638 1:150556012-150556034 TGGGTCTGGCTGGGGATGGTGGG + Intronic
915153403 1:153853923-153853945 GGGCTCTGGCTGGGGGTAGATGG - Intronic
915640602 1:157221625-157221647 GGGGTTGGGGTGGGGATATAGGG - Intergenic
915708963 1:157875078-157875100 AGGCTCTGGGTGGTGAGAGGAGG - Intronic
915913327 1:159927668-159927690 AGGGCCTGACTGGGAATAGATGG + Intronic
915942242 1:160125684-160125706 AGGGTCTGGGAGGGCCAAGAAGG + Intronic
916180277 1:162077683-162077705 AGGGTGGGGGTGGGGAGTGAAGG - Intronic
916420692 1:164635101-164635123 AGGGTGGGGGTGGGGAGAAAAGG + Intronic
916517237 1:165530901-165530923 AGAGTATGGGTGGGCAAAGATGG + Intergenic
917155810 1:171997373-171997395 TGGGGCTGGGGTGGGATAGAAGG + Intronic
917647354 1:177042171-177042193 AGAGTCGGGGTGGAGGTAGAAGG + Intronic
918354989 1:183699596-183699618 TGGCTCTAGCTGGGGATAGAAGG - Intronic
919674067 1:200364402-200364424 AGGGTGGGGGTAGGGCTAGAGGG - Intergenic
919933097 1:202234332-202234354 TGGGAATGGGTGGGGATAGGAGG - Intronic
920815118 1:209324050-209324072 AGGATTAGGGTGGGGATACAGGG + Intergenic
920971786 1:210749145-210749167 AGGGGCTGGGTGGACATAGTGGG - Intronic
921333551 1:214064247-214064269 AGGGTCGGGATGGGGATGGTCGG + Intergenic
921776840 1:219111586-219111608 AGGATCTGAGAGTGGATAGAGGG + Intergenic
922083696 1:222324747-222324769 AAGGTCTGGGTAGGGCTACATGG - Intergenic
922085046 1:222338497-222338519 AGGGTGTGGGTGGATATAAAGGG - Intergenic
922249460 1:223834806-223834828 AGTGTGTGGGTAGGGATGGATGG - Intronic
922775561 1:228212960-228212982 GGGGACTGGGTGGGGAAAGCGGG - Intronic
922797784 1:228349772-228349794 ATGGTCGGGGAGGGGATGGAGGG - Intronic
922981543 1:229831254-229831276 ATGGTCTGGCTGGGGAAAGGTGG - Intergenic
924282888 1:242455909-242455931 AGAGCCGGGGTGGGGACAGAAGG + Intronic
1062849569 10:733242-733264 AGGGAGTGGGTAGGGAGAGAAGG - Intergenic
1063155370 10:3374363-3374385 ACCACCTGGGTGGGGATAGAGGG + Intergenic
1064031375 10:11885397-11885419 AGGGGATGGGTGGGTAGAGATGG + Intergenic
1064031396 10:11885475-11885497 AGGGGATGGGTGGGTAGAGATGG + Intergenic
1067385078 10:45811558-45811580 AGAGACTGGATGGGGACAGATGG - Intergenic
1069539314 10:69281715-69281737 AGGGTTTGGGTGGGGAATGGTGG + Intronic
1069558779 10:69415206-69415228 TGGGCCTGGGTTGGGAGAGAGGG - Intronic
1070825026 10:79385918-79385940 AGGTTCTGGGTGGGGGCAGGCGG + Exonic
1071207460 10:83297711-83297733 AGAGTCAGGGTGTGGATAAATGG + Intergenic
1072161646 10:92772192-92772214 AGGGCCTGGGGAGGGATGGAGGG + Intergenic
1072749816 10:97969713-97969735 TAGGTCTGGGTGGGGAGATAAGG - Intronic
1073318002 10:102596457-102596479 AGGGTCTCGATGGGGAGAGAAGG + Intronic
1073521909 10:104139415-104139437 TGTGTCTAGGTGGGGATAGGGGG - Intronic
1073728594 10:106264825-106264847 AGGGGCTAGGTGGGGAGGGAAGG + Intergenic
1073833235 10:107411023-107411045 AGGGTCTGGTGGGAGATAAATGG + Intergenic
1074374932 10:112932686-112932708 AGAGACTGGGTGAGGATAAATGG + Intergenic
1074410624 10:113225480-113225502 AGTGAGTGGGTGGGGACAGAAGG + Intergenic
1074941792 10:118243696-118243718 GGGGGCGGGGTGGGGATAAATGG - Intergenic
1075099604 10:119496873-119496895 GGGGGCGGGGTGGGGAGAGAGGG - Intergenic
1075347832 10:121697231-121697253 AGTGTCTGGGTAGGGGGAGATGG + Intergenic
1075560955 10:123468113-123468135 AGGGTCTGTCTGGGGGTTGAGGG - Intergenic
1076078509 10:127556780-127556802 AGGGTGAGGGTGGAGAGAGATGG + Intergenic
1076120181 10:127930283-127930305 AGGGTAGGGGTGGGGTTACAGGG - Intronic
1076153542 10:128184924-128184946 AGGGTCTGGGGAGAGATAAATGG - Intergenic
1076549875 10:131271461-131271483 AGGGTCTGGCTGGGGTCAGCAGG - Intronic
1076829181 10:132985743-132985765 AGGGTCTAGGTGGGGGTGCAGGG + Intergenic
1076980268 11:200390-200412 AGGGTCTGTGTGGGGAGAGATGG + Intronic
1077993029 11:7428993-7429015 AGGGTCTGTGTTGGAATAGGTGG + Intronic
1078344223 11:10530044-10530066 AGAGCCGGGGTGGGGATAGGAGG + Intronic
1078440080 11:11357456-11357478 AGGGAGTGGGTGGAGATTGATGG - Intronic
1078449770 11:11432058-11432080 AGGGTCTGGCTAGGGACAGATGG + Intronic
1078507647 11:11964678-11964700 AGGCTGTGGCTGGGGAGAGATGG + Exonic
1079081516 11:17416607-17416629 AGGGTCTGGTGGGAGAGAGAGGG - Intronic
1079697962 11:23507581-23507603 AGAGTTTGGCTGGGGATAGTTGG + Intergenic
1080323548 11:31043690-31043712 AGGGTTTGGGAGGTGACAGAAGG - Intronic
1081671530 11:44945293-44945315 AGGGTTGTGGTGGGGATAGCAGG - Intronic
1081854737 11:46296209-46296231 TGGGTGTGGTTGGGGGTAGAGGG + Intronic
1083043993 11:59715872-59715894 ATGTTTTGGGTGGAGATAGAGGG + Intronic
1083197904 11:61102128-61102150 GGGGTCTGGGTGGGGAGAGGCGG - Intergenic
1083491630 11:63018471-63018493 AGGGTGGGAGTGGGGAGAGAGGG - Intergenic
1083782445 11:64925342-64925364 AGGGTCTGGGCAAGGATAGGAGG + Intronic
1084062465 11:66685368-66685390 AGGGTGGGGGTGGGGAGGGAGGG + Exonic
1084164114 11:67367109-67367131 CGGGGTTGGGTGGGGACAGAGGG - Intronic
1085377976 11:76084696-76084718 AGGCTCTGGGTGGTGGTGGAGGG + Intronic
1086419169 11:86621017-86621039 AAGGTCTGGGTTGGGATCCAAGG + Intronic
1087846623 11:102980811-102980833 AGGGCCTGGTTGGGGATGGGGGG + Intergenic
1088583237 11:111335174-111335196 AGGGACTGGGAGTGGGTAGAAGG + Intergenic
1088861531 11:113804817-113804839 TTGGTCTGGGTTGGGCTAGATGG - Intronic
1089070577 11:115696561-115696583 AGGTTCTGTGATGGGATAGATGG - Intergenic
1089502728 11:118941768-118941790 AGGGGCTGGGTGGAGATATTTGG - Intronic
1089678785 11:120108032-120108054 GGGGGCTGGGTGGGCACAGAAGG - Intergenic
1089732889 11:120530383-120530405 GGGGTGTGGGTGGGGGTAGGGGG + Intronic
1090290095 11:125535815-125535837 AGTGTCTGGGTTAGGATAAAAGG - Intergenic
1091224518 11:133949682-133949704 AGAGCCTGGGTGGGGGCAGATGG + Intronic
1091413753 12:262141-262163 AGGGTCTGGGAGGGTGGAGAAGG - Intronic
1091942290 12:4498736-4498758 GGGGTGAGGGTGGGGATAGCAGG + Intronic
1093520147 12:20040830-20040852 ATGGTGGGGGTGGGGACAGATGG - Intergenic
1093720403 12:22436296-22436318 AGGGTTTGGGTGCTGGTAGAGGG + Intronic
1093744435 12:22723623-22723645 AGTGTCTAAGTGGGTATAGAAGG - Intergenic
1093925646 12:24905843-24905865 AGGGTCTGGGTGGAGAGGAATGG + Intronic
1094059123 12:26294781-26294803 AAGGACTGAGTGGGGATAGGGGG - Intronic
1094078828 12:26510009-26510031 GGGGTGGGGGTGGGGAGAGAAGG + Intronic
1094673457 12:32594552-32594574 TGGGTTGGGGTGGGGAGAGAGGG - Intronic
1095465975 12:42488399-42488421 AGGGTTAGGGTGGGCAAAGATGG - Intronic
1096130677 12:49156382-49156404 ATGCCCTGGGTGGGGGTAGAAGG - Intergenic
1096238998 12:49949485-49949507 AGGCTCAGAGTGGGGACAGAAGG - Intergenic
1096496011 12:52039897-52039919 AGGCCCTGAGTGGGGAGAGAAGG + Intronic
1096589023 12:52644977-52644999 AGAGTCTGGGTTGGGAGAGTCGG + Exonic
1096820213 12:54227903-54227925 AGGGTAGGGGTAGGGATAGGGGG - Intergenic
1101460329 12:104884530-104884552 AGGGTGGGGGTAGGGATGGAGGG - Intronic
1102042602 12:109810324-109810346 AGGGTCTGGGAGGGAGAAGAGGG + Intronic
1103136128 12:118509410-118509432 AGGGTATGGGTGGGGAGGCACGG + Intergenic
1104640837 12:130465873-130465895 AGGTGCTGGGTGGGGGCAGAGGG - Intronic
1105286553 13:19008968-19008990 AAGGTCTGGTTGGGGATGGCAGG - Intergenic
1105437622 13:20391335-20391357 GGGGTCTGGGTGGGGAAGGAAGG + Intergenic
1105437705 13:20391543-20391565 GGGGTCGGGGTGGGGAAAGGAGG + Intergenic
1105759050 13:23496428-23496450 AGAGTCTGCGTGGTGGTAGAGGG + Intergenic
1105812749 13:24009126-24009148 AGAGTTTAGGTGGGGATAGCAGG - Intronic
1106186196 13:27412087-27412109 AGGGTGGGGGTGAGGATGGAGGG + Intergenic
1106769245 13:32945593-32945615 AGGCTTGGGGTGGGGATAGATGG + Intergenic
1106923415 13:34588682-34588704 AGAGGCTGGTTGGGGATAGAGGG + Intergenic
1107251456 13:38368415-38368437 ACAGTGTGGGTGGAGATAGAAGG - Intergenic
1107426149 13:40294961-40294983 AGGGTGTGGTTGGGGAGAGGAGG + Intergenic
1110196588 13:72795854-72795876 AGGGGTTGGTTGGGGATAGTGGG + Intronic
1110234723 13:73204651-73204673 AGGGTCGGGGCAGGGAGAGACGG + Intergenic
1110299957 13:73914753-73914775 ATGGTCTGGGTGGGGGGTGATGG + Intronic
1110504610 13:76271207-76271229 AGGGCCTGTCTGGGGATGGAGGG - Intergenic
1110889821 13:80684813-80684835 AGGACCTGGGTGGGTACAGAAGG + Intergenic
1112138813 13:96614488-96614510 AGGGTGTTGGTGGGGATGGTGGG + Intronic
1112565425 13:100547831-100547853 GGGGCCTGGGTGGGCAGAGAAGG - Intronic
1112773888 13:102823425-102823447 AGGGTCAGTGTGAGGATAAAAGG + Intronic
1113135283 13:107082022-107082044 AGGGTATGGGAAGGGCTAGAAGG + Intergenic
1113431316 13:110254057-110254079 AGGTTGTGGGTGGGGTCAGAGGG - Intronic
1113701218 13:112390103-112390125 AGGGGCTGAGTGGGAAGAGAAGG + Intronic
1113827488 13:113268007-113268029 ATGGTCTGGGTGAGGACAGACGG + Intergenic
1114067634 14:19077985-19078007 AGGGCCTGTGTGAGGGTAGAGGG - Intergenic
1114094623 14:19322041-19322063 AGGGCCTGTGTGAGGGTAGAGGG + Intergenic
1114524739 14:23360482-23360504 AGGCCCTGGGTGGGGCTAGTTGG + Intronic
1114665758 14:24376405-24376427 AGGGTCTTCATGGGGATAGGAGG - Exonic
1116510836 14:45744666-45744688 ATGGACTGGGTGGGGAATGATGG - Intergenic
1118796938 14:69152658-69152680 AGGGAGGGGGTGGGGACAGAGGG + Intronic
1119172649 14:72546670-72546692 AGGGCCTGGGCGGGGGTCGAGGG - Intronic
1119728008 14:76933765-76933787 AGGGCCTGGGTAGGGGTAGGAGG - Intergenic
1121198404 14:92096166-92096188 AGGGTGGGGGTGGGGAAAGAAGG + Intronic
1121406231 14:93720848-93720870 AGGGTGTCAGTGGGGATAGGAGG + Exonic
1121431073 14:93888839-93888861 AGGGTCGGGGTGGGTCTAGGGGG + Intergenic
1121798755 14:96756132-96756154 AGGGCCAGGGAGGGGATGGAGGG - Intergenic
1122134361 14:99624381-99624403 AGGGTTATGGTGGGGACAGAAGG + Intergenic
1122234972 14:100326243-100326265 AGGGGCTGGGTAGGGAGACAGGG + Intronic
1122301851 14:100735870-100735892 GGGTTCTGGGTGGGCAAAGAGGG - Exonic
1122638111 14:103139515-103139537 AGGGCCTGGGAGGGGAGAAAGGG + Intergenic
1122670666 14:103369351-103369373 AGGGTCGGGGTGGGGGTCGGGGG - Intergenic
1124011557 15:25843266-25843288 TGGGTTTGGGTGGTGATAGGTGG - Intronic
1124362042 15:29044683-29044705 AGGCTCTGGGAGGGGAGAAAAGG + Intronic
1124495823 15:30186286-30186308 AGGGGCTGGGGGGGGAAGGAGGG - Intergenic
1124707545 15:31978026-31978048 AGGATCGGGGTGTGGACAGAGGG - Intergenic
1125520041 15:40343459-40343481 TGGGTCTGGGAGGAGAAAGAAGG - Intergenic
1126561902 15:50053067-50053089 TGGATCAGGGTGGGGACAGAAGG + Intronic
1127975880 15:63996980-63997002 GAGGGCTGGGTGGGGACAGAAGG + Intronic
1128079022 15:64845303-64845325 AGGGCCTGGGTGAGGAGGGATGG + Intronic
1128124952 15:65185378-65185400 AGGCTGGGGGTGGGGGTAGAAGG - Intergenic
1128247667 15:66144038-66144060 AGGCTCCAGGTGGGGATATAGGG + Intronic
1128288758 15:66460801-66460823 AGGGACAGGATGGGGACAGATGG + Intronic
1129227053 15:74176138-74176160 AAGCCCTGGGTGGGGCTAGAAGG - Exonic
1129763112 15:78143355-78143377 AGGGTCTGGGAGAGGGGAGATGG + Intronic
1130227279 15:82068911-82068933 AAGCCCGGGGTGGGGATAGAGGG - Intergenic
1130373337 15:83305921-83305943 AGGGTGGGGATGGGGATAGGAGG + Intergenic
1130672959 15:85929048-85929070 AAGGTCTTGGTGAGGAGAGAGGG + Intergenic
1130895199 15:88164668-88164690 GGGGGCAGGGTGGGGAGAGAGGG - Intronic
1131383177 15:91981201-91981223 AGGGTCTGGCTGGTGGGAGAAGG - Intronic
1131417802 15:92276032-92276054 GGGGTATGGGTGGGGGAAGAGGG + Intergenic
1133360387 16:5169291-5169313 CGGGCCTGGGTGAGGAGAGATGG - Intergenic
1133559875 16:6941232-6941254 AGGGAATGGGAGGGGATGGAGGG - Intronic
1134561832 16:15217496-15217518 AAGGTCTGGGTGGCAATTGATGG - Intergenic
1134922370 16:18129120-18129142 AAGGTCTGGGTGGCAATTGATGG - Intergenic
1135563199 16:23492598-23492620 AAGGTCTTGGTGGGGCAAGAGGG - Intronic
1136222300 16:28836246-28836268 GGGTTCTGGGTGGGGAGTGAGGG + Intronic
1136407200 16:30054932-30054954 GGGGTCTGGTCGGGGATAAAGGG + Intronic
1137675057 16:50299974-50299996 AGGGATTGGGGGGGCATAGAAGG + Intronic
1139148683 16:64353119-64353141 AGGGTCTGGGTAGTGATATGAGG - Intergenic
1139851113 16:69952016-69952038 AGGGCTGGGGTGGGGAGAGAAGG - Exonic
1140372418 16:74420589-74420611 AGGGCTGGGGTGGGGAGAGAAGG + Exonic
1140649051 16:77066599-77066621 AGGGTAGGGGTGGGGGTAGGAGG + Intergenic
1141139467 16:81487722-81487744 AGGGTCTGTGTGAGGATTAAAGG + Intronic
1141178912 16:81739129-81739151 AGTGTCTGGGTGGGGGCAGGGGG + Intronic
1141430247 16:83967621-83967643 AGGGTAGGGGGGTGGATAGATGG + Intergenic
1141570423 16:84930537-84930559 GGGGTGTGGGTGTGGATAAATGG + Intergenic
1141881830 16:86865336-86865358 AGGGGCTGGGAGGGCACAGAGGG + Intergenic
1142105570 16:88300679-88300701 AGGGGCTGGGTGGGTGAAGAAGG - Intergenic
1142482803 17:229184-229206 AGCATCTGGGTGGGGAGAGGAGG - Intronic
1142854832 17:2723879-2723901 AGGGTCAGGGTGGGGGTAGAAGG + Intergenic
1142976173 17:3645949-3645971 AGGGTCTGGGTGGGGGGAACTGG + Intronic
1143113084 17:4564121-4564143 GGGTTGGGGGTGGGGATAGAAGG + Intergenic
1143481688 17:7230833-7230855 GGGGTCGGGGTGGGGATGGTTGG - Intronic
1143622851 17:8090956-8090978 AGGGGTTGGGTGGGGAGGGAGGG + Intergenic
1143767640 17:9148083-9148105 AGGGGCTGGGTAGGGGCAGAGGG + Intronic
1144380169 17:14687159-14687181 GGGGCCGGGGTGGGGAGAGATGG + Intergenic
1144733570 17:17542382-17542404 GGGGACTGGCTTGGGATAGAGGG + Intronic
1144942043 17:18948559-18948581 TGGGTTTGGGTGGGGAGTGATGG + Intergenic
1145013971 17:19385052-19385074 AGGGGCTGTGAGGGGAAAGAAGG - Intronic
1145836340 17:27956868-27956890 AGGCTCAGGGAGGGGAGAGAGGG - Intergenic
1145883286 17:28366920-28366942 AGGGTCTTGGAGGAGAGAGAAGG - Intronic
1146313591 17:31789926-31789948 AGTGTCTGGGTGGTGTTTGAAGG + Intergenic
1146679404 17:34796248-34796270 AGGGCCAGTGTGAGGATAGATGG - Intergenic
1147256463 17:39184989-39185011 AGGGTGGGGGTGGGGAGGGATGG + Intronic
1147359460 17:39921938-39921960 AGGGTCAGGTTGGGGAAAGATGG - Intronic
1147387661 17:40091579-40091601 GGGGTTGGGGTGGGGATGGAGGG - Intronic
1147567705 17:41547855-41547877 TGGGTCTGTGTGGGGAGAGACGG - Intergenic
1147742974 17:42679252-42679274 AGGGCCTGGGTGGGGGTGGGGGG - Exonic
1147744521 17:42687150-42687172 AGCATCTGGCTGGGGACAGAGGG - Intronic
1148450336 17:47773556-47773578 AGGTTCTGGCTTGGGATAAAGGG - Intergenic
1148457729 17:47820041-47820063 CGGGTCAGGCTGGGGACAGAGGG - Exonic
1148497254 17:48060204-48060226 AGGGTGGGGGTGGGGAGGGACGG + Exonic
1148712029 17:49688865-49688887 GTGCTCTGGGTGGGGAAAGAGGG + Intergenic
1148810606 17:50288489-50288511 AGGGTGGGGGTGGGGGCAGATGG - Intergenic
1149328309 17:55555766-55555788 AGGGACCGAGTGGGGAGAGAGGG - Intergenic
1149614985 17:57989461-57989483 AGTGTCTGGAGGGGGATAAATGG - Intronic
1150139773 17:62717830-62717852 AGGATCTGGGTGGGAAGAGATGG - Intronic
1150493089 17:65587725-65587747 GGGGTGGGGGTGGGGAGAGAGGG + Intronic
1150898009 17:69236726-69236748 AGGGTTGGGGTGGGGGTAGGGGG - Intronic
1151477526 17:74352474-74352496 AGGCTTTGGGTGGGGTAAGAAGG - Intronic
1151701055 17:75742763-75742785 TGGGTCTGGGTGGGGAGAGTGGG + Intronic
1151955629 17:77378833-77378855 AGGGTGGGGGTGGGGGTAGATGG - Intronic
1151990258 17:77570133-77570155 AGGGCCTGGCTGGGGATATCTGG + Intergenic
1152376277 17:79920356-79920378 GGGGGCTGGGTGAGGAGAGAGGG + Intergenic
1152646220 17:81469685-81469707 TGGGTGTGGGTGGGGACACAAGG - Intergenic
1152884888 17:82843848-82843870 ACGGTCTGGGTGGGGAAGGGTGG - Intronic
1154301456 18:13196298-13196320 AGGGGCTGGGTGAGGATAAAAGG - Intergenic
1155235763 18:23817070-23817092 AGGGTTGCGGTGGGGGTAGAGGG + Intronic
1156431710 18:37081818-37081840 AGAGTCGGGGTGTGGATAAATGG - Intronic
1156481071 18:37436744-37436766 AGGGAATGGCTGGGGCTAGAGGG + Intronic
1156674912 18:39515888-39515910 TGGATCTGGCTGGGGAAAGAGGG - Intergenic
1156780019 18:40839617-40839639 AGGGGATGGTTGGGGATATAGGG + Intergenic
1156816765 18:41320726-41320748 AGGTTATGGGAGGGGAAAGAAGG - Intergenic
1157113749 18:44844302-44844324 TGGGGCAGGGTGGGGAGAGAAGG - Intronic
1157248385 18:46072587-46072609 AGGCTCTGCGGGGTGATAGACGG + Intergenic
1157483280 18:48069600-48069622 AGGGGGTGGGAGAGGATAGAGGG - Intronic
1157698432 18:49743753-49743775 GGGGTCAGGGTGGGGAGAGGTGG + Intergenic
1157947906 18:52001895-52001917 AGGGCCTGGGTGGTTACAGAAGG + Intergenic
1159070163 18:63613950-63613972 AGGGTCTGTGTGGGGAGACCAGG - Intergenic
1159415482 18:68142308-68142330 AGGATATGGGTGGGCAAAGAAGG + Intergenic
1160328453 18:77970481-77970503 AAGGTCTGGGAAGGGACAGATGG - Intergenic
1160704981 19:525429-525451 AGGGTCTGGGTGGTGAGTGCGGG - Intergenic
1161248570 19:3268651-3268673 AGGGTCTTGGTGGGGAACGGAGG + Intronic
1161303724 19:3555889-3555911 AGGGTCCGGGAGGGGAGAGGAGG + Intronic
1161312440 19:3602370-3602392 AGGGACTGGGTGGGCAAAGGTGG + Intronic
1161349787 19:3785300-3785322 AGGGGCAGGGTGGGGAAATAGGG + Intronic
1161646163 19:5454777-5454799 AGGGTCAGGGTGGGGCTGGTGGG - Intergenic
1161962319 19:7529572-7529594 AGGATCTGGGTTGGGGCAGAGGG - Exonic
1161993260 19:7697349-7697371 AAGGGATGGGTGGGGGTAGATGG - Intronic
1163090975 19:15020443-15020465 AGGGTCTGGGTGGGGAGGGGAGG - Exonic
1163314353 19:16532074-16532096 GAGGGCTGGGTGGGGACAGAGGG + Intronic
1163390468 19:17027165-17027187 AGGGGCTGGCTGGGGAGGGAGGG - Intergenic
1163501571 19:17679547-17679569 AGGCTCTGGGGGGTGATACAAGG + Intronic
1163586713 19:18168375-18168397 AGGGTCTGGCTGAGGAGAGAGGG - Intronic
1163684729 19:18704938-18704960 AGGGGCTGGGAGGGAATGGAGGG - Intronic
1163717530 19:18880630-18880652 AGGGTCTGGTTGGGGGTGCACGG - Intronic
1163887729 19:19982858-19982880 AGGGTCTGCTTGAGAATAGAGGG + Intergenic
1164454815 19:28398259-28398281 TGTGTCTGGCTGGGGATAGGAGG - Intergenic
1165158601 19:33802960-33802982 TGGGGCTGGGTGGGGGGAGATGG - Intronic
1165668616 19:37655562-37655584 CGGGTCTCGGCGGGGATAGTCGG + Intronic
1165795165 19:38515130-38515152 TGGGGCTGGGTGGGGCTGGAGGG + Intronic
1166316618 19:41993142-41993164 AGGGGGTGGGTGGGGGTAGGTGG - Intronic
1166376951 19:42333051-42333073 AGACTCTGGATGGGGACAGAGGG + Intronic
1166567146 19:43772202-43772224 AGGGGATGGGAGGGTATAGAGGG - Intronic
1167279594 19:48559161-48559183 AGGGGCTGGGTGGAGAAGGAGGG - Intronic
1167605385 19:50479088-50479110 TGGGTGTGGATGGGGATGGAGGG + Intronic
1167654560 19:50755105-50755127 AGGCTCAGGGTGGGGATGGGGGG + Intergenic
1168236594 19:55067511-55067533 AGGGTATGGGAGGGGGTGGAAGG + Intronic
1168405465 19:56108204-56108226 AGGGGCTGGGTGGAGAGAGCGGG - Intronic
1168607245 19:57769905-57769927 AGGGTCTGGGTGGGTAGGGTGGG - Intronic
1168609308 19:57786543-57786565 AGGGTCTGTGTGGGGATGGCGGG - Intronic
925056352 2:860531-860553 AGGGTGTGGGTGGGGGTCCAGGG - Intergenic
925146774 2:1587568-1587590 AGGGACAGGGCGGGGACAGAGGG - Intergenic
925146781 2:1587587-1587609 AGGGACAGGGTAGGGACAGAGGG - Intergenic
925146804 2:1587677-1587699 AGGGACAGGGTGCGGACAGAGGG - Intergenic
925146815 2:1587713-1587735 AGGGACTGGGTGGGGACAGAGGG - Intergenic
925146830 2:1587756-1587778 AGGGACAGGGCGGGGACAGAGGG - Intergenic
925146837 2:1587775-1587797 AGGGACAGGGTAGGGACAGAGGG - Intergenic
925146865 2:1587886-1587908 AGGGACAGGGTGAGGACAGAGGG - Intergenic
925146876 2:1587922-1587944 AGGGACTGGGTGGGGACAGAGGG - Intergenic
925146898 2:1587982-1588004 AGGGACAGGGTGGGGACAGAGGG - Intergenic
925146911 2:1588020-1588042 AGGGACAGGGTGGGGACAGAGGG - Intergenic
925146929 2:1588083-1588105 AGGGACAGGGCAGGGATAGACGG - Intergenic
925146934 2:1588102-1588124 AGGGACAGGGCGGGGACAGAGGG - Intergenic
925218220 2:2115742-2115764 AGTGTCGGGGTGGGGACAGCGGG + Intronic
925269272 2:2590765-2590787 AGGGGCTTGGTGGGGCCAGATGG + Intergenic
925815708 2:7746281-7746303 GGAGTCTGAGTGGGAATAGACGG - Intergenic
925853676 2:8108748-8108770 AGGGTCTGGGAGTGGAGAGATGG - Intergenic
926225405 2:10963672-10963694 AGGGTCTGGATGGGGGAATAAGG - Intergenic
926243359 2:11104706-11104728 AGGGTCTGTGAAGGGAGAGAAGG - Intergenic
926567091 2:14488151-14488173 AGGGCCTGGGTGAAGACAGAGGG - Intergenic
926890435 2:17634825-17634847 AGGCTCTGGCTGGGGTTTGAGGG - Intronic
926940112 2:18126638-18126660 AGGGTCTGGGTGGGAATAGAGGG + Intronic
928006435 2:27566397-27566419 AGTTTCTGGGTGGGGATTGAAGG + Intronic
928105156 2:28465824-28465846 GGGGACTGAGTGGGGAAAGATGG - Intronic
928232950 2:29515558-29515580 ATGGTAGGGGTGGGGATAGGGGG + Intronic
928246930 2:29638515-29638537 AGGGTGGGGGTGGGGGGAGATGG + Intronic
928398325 2:30960149-30960171 ATGGTCAGGGAGGGGAAAGAAGG + Intronic
929869093 2:45743098-45743120 AGGGGCTGGGTGGGGAGTGAGGG + Intronic
930110790 2:47676894-47676916 AGAGTCAGGGTGGGAATGGAGGG - Intergenic
930164396 2:48189983-48190005 CGGGTCTGGGTGGGGTCAGTGGG + Intergenic
930576085 2:53150514-53150536 AGGGTGTGGGTGGGGAGAGAGGG + Intergenic
931026856 2:58119864-58119886 AGGTTGAGGGTGGGGATGGATGG + Intronic
932079095 2:68695142-68695164 AGGTTCTGGGTGGGGCCACAGGG - Intronic
933632327 2:84672157-84672179 GGGGCCTGGGTGGGGCCAGAAGG + Intronic
934576768 2:95406895-95406917 AGGGTCTGGCTGGGAACAGGTGG - Intronic
934638987 2:96015063-96015085 AGGGTCTGGCTGGGAACAGGTGG - Intergenic
934734833 2:96684844-96684866 GGGGGCTGGGTGGGGGTAGAAGG + Intergenic
934794661 2:97090349-97090371 AGGGTCTGGCTGGGAACAGGTGG + Intronic
936043237 2:109165731-109165753 AGGATCTGAGTGGGGAGAGTGGG - Intronic
936250937 2:110867619-110867641 AAGGTCTGGGTGGGGACTGGAGG + Intronic
937092913 2:119218358-119218380 AGGGTCTCAGTGGGGATTGAAGG + Intergenic
938774329 2:134528087-134528109 AGGATCTGGATGGTGTTAGAAGG - Intronic
940078128 2:149767079-149767101 AGTGGCTGGTTGGGGAAAGAGGG - Intergenic
940484956 2:154286948-154286970 AGGGTCTTGGTAGTGATGGATGG - Intronic
940698289 2:157008565-157008587 CGGGTCTGGGTTAGGAGAGAGGG + Intergenic
942080416 2:172394892-172394914 AGGCTCTGGGTGGGGGGAGGGGG + Intergenic
942247081 2:174017842-174017864 AGGGTCTGGGGGTGCAGAGAGGG + Intergenic
945274083 2:207970623-207970645 AGGGTCTGAGTGGGAATCAAAGG - Intronic
945417875 2:209597788-209597810 AGGGTGGGAGTGGGGAGAGATGG - Intronic
945502508 2:210593397-210593419 AGGGTGTTGGAGGGGAGAGAGGG + Intronic
946246846 2:218392807-218392829 AGGGGATGGGTGGGGAGAAATGG - Intronic
946741468 2:222806771-222806793 GGGGGCTGGGTGGGGACAGGTGG - Intergenic
946922170 2:224591442-224591464 ATGGTATGGGTAGAGATAGAAGG + Intergenic
947713919 2:232330534-232330556 AGGGGATGGGTGGGGAGAGGGGG - Intronic
947828899 2:233125215-233125237 AGAGTCTGGGGGAGGAGAGAAGG + Intronic
948101037 2:235373534-235373556 GGGGTGGGGGGGGGGATAGAAGG - Intergenic
948423272 2:237873429-237873451 AGTGACAGGGTGGGGACAGAAGG - Intronic
948654123 2:239466162-239466184 CTGGTTTGGGTGGAGATAGAGGG - Intergenic
1169280469 20:4262825-4262847 AGGGTCAGGGTGCAGGTAGAGGG + Intergenic
1170099145 20:12679295-12679317 AGGGTGTGGCTGTGGAGAGAAGG + Intergenic
1170418081 20:16165565-16165587 AGGAGCAGGGTGGGGATCGATGG + Intergenic
1171249678 20:23638198-23638220 AGGGGCTGGGAGGGGAGGGAAGG - Intronic
1172185957 20:33031223-33031245 AGGGTCAAGGTGGGGACACAGGG + Intergenic
1172390301 20:34560975-34560997 AGGATCTGGGGGGAGAGAGAGGG + Exonic
1172468591 20:35174977-35174999 GGGGTCTGGGCGGGGCTAGTGGG + Intronic
1172566511 20:35934730-35934752 GGGGTGGGGGTGGGGATAAAAGG + Intronic
1172914564 20:38434124-38434146 GGACTCTGGGTGGGGACAGATGG - Intergenic
1173086558 20:39925004-39925026 AAGGTCTGGGTGGGGGTGGAAGG - Intergenic
1173152492 20:40579565-40579587 AGGGCCTGGTTGGGTGTAGAGGG - Intergenic
1175276645 20:57775169-57775191 AGGGCCTGGGTTGGGACAGAGGG + Intergenic
1175764493 20:61583122-61583144 AGGCTCTGCGGGGGGACAGAGGG + Intronic
1176108226 20:63399398-63399420 AGGGTCTGAGAAGGGCTAGAGGG - Intergenic
1176383859 21:6127359-6127381 GGGGTGGGGGTGGGGAGAGAGGG + Intergenic
1179049701 21:37878739-37878761 TGGGGCTGGGTGGGGAAAGAGGG + Intronic
1179739614 21:43410879-43410901 GGGGTGGGGGTGGGGAGAGAGGG - Intergenic
1180179766 21:46112720-46112742 CGAGTCTGGGTGGGGATGGAGGG - Intronic
1180188413 21:46151516-46151538 AGGGGCTGGGTGGGGCTCCATGG + Intronic
1180486109 22:15800555-15800577 AGGGCCTGTGTGAGGGTAGAGGG - Intergenic
1180874372 22:19168337-19168359 AGGGGATGGGTGTGCATAGATGG - Intergenic
1181165207 22:20979538-20979560 AGGGCCTGGGCGGGGTTAGGAGG + Intronic
1181294716 22:21827518-21827540 ATGGTCTGGGTGAGGCTAGCTGG + Intronic
1181967433 22:26666871-26666893 GGGGTCTGTGTGGGGAAGGAAGG + Intergenic
1182560453 22:31155020-31155042 AGGGTCTGTGAAGGGATGGAAGG - Intergenic
1183353518 22:37346396-37346418 AGGGCCTGGGTTGGGAGGGAAGG - Intergenic
1183467440 22:37986804-37986826 AGGGCCTGGGATGGGATGGAGGG - Intronic
1183494987 22:38138065-38138087 ATGGCCTGTGTGGGGACAGAGGG + Intronic
1183689737 22:39381954-39381976 AGGGGCTGGGTGTGGAGAGAGGG - Exonic
1183891392 22:40931986-40932008 AGGGTGTGGGTGTGGATATTTGG - Exonic
1185219879 22:49623953-49623975 AGGGTCTGGGTGGCACTTGAGGG - Intronic
949148749 3:738362-738384 AGGCATTGGGTGGGGATGGAGGG - Intergenic
950162677 3:10772044-10772066 AGGGTCGGGCTGGGGAGGGAGGG + Intergenic
950248668 3:11445516-11445538 AGGGTCTGGTGGAGGATGGAGGG + Intronic
950582295 3:13870544-13870566 ATGGTCTGGGTGGGGCTACCAGG + Intronic
951710387 3:25580747-25580769 TGGGTCTGGGGAGGGAGAGAGGG + Intronic
952932967 3:38374346-38374368 AGGGTGTGGGTGGGGGTTGGAGG + Intronic
953061777 3:39433910-39433932 AGGGTTTTGGTGTGGACAGAGGG - Intergenic
954381958 3:50224047-50224069 AGGCTCTGGGTGGGGAATGGGGG + Intergenic
954460825 3:50625918-50625940 AGGGTGGGGGTGGGGAAGGAAGG + Intronic
955029573 3:55203326-55203348 AGGGGCAGGGTGGGGGAAGAGGG + Intergenic
956150962 3:66241806-66241828 GGGGTTGGGGTGGGGCTAGAGGG + Intronic
956430530 3:69181483-69181505 AGGGTCTGGGTGGTGTAATAGGG + Exonic
956551654 3:70467553-70467575 AGGGTAGGGATGGGGAAAGAGGG - Intergenic
956623591 3:71245549-71245571 AGGGGGTGGGTGGGTAGAGAAGG - Intronic
957754419 3:84467970-84467992 AGGGTCTTGTTGGGGAAGGATGG - Intergenic
958479328 3:94626705-94626727 AGAGCCTGGGTGGAGAGAGAAGG - Intergenic
959148201 3:102575088-102575110 AGGGTCTGTCGGGGGGTAGAGGG + Intergenic
959667770 3:108940947-108940969 AGGGTCAGAGTGGGGACAGGAGG + Intronic
960725805 3:120668509-120668531 AGTGGCGGGGTGGGGAGAGAGGG + Intronic
960940396 3:122929396-122929418 AGGGCCTGGGGTGGGATTGAAGG - Intronic
961182503 3:124887440-124887462 AGGGCCTGGCAGGGGAGAGAAGG - Intronic
961574262 3:127822432-127822454 AGGGTCTGGGTGCGGGAAGAGGG - Exonic
961615116 3:128173139-128173161 AGGGTCTGGGTAGGAAAAGAAGG + Intronic
962274477 3:134001634-134001656 AGGGTCTGGGTAAGGAAAGGTGG + Intronic
962346850 3:134624895-134624917 AGCATATGGGTGGGGACAGAAGG - Intronic
962921341 3:139953245-139953267 AGGATCTGTGTGGGCATAGAGGG - Intronic
963736098 3:149019417-149019439 AGGGGGTGAGTGGGGAGAGATGG - Intronic
964412477 3:156413172-156413194 AGGGTCTGAGTGGGGATAGAAGG + Intronic
966456219 3:180118790-180118812 AGTTTCTGGGTGGCGATAAAGGG - Intergenic
967361064 3:188632387-188632409 AGGGCCTGGGTGGGGAGACTGGG + Intronic
967778338 3:193407867-193407889 AGGGCTTGGCTGGGGAGAGACGG - Intronic
967945749 3:194802397-194802419 AGGATCTGGGTGAGGATGGAGGG - Intergenic
968978232 4:3833012-3833034 AGCCTGTGGGTGGGGAGAGAGGG + Intergenic
969049656 4:4363641-4363663 AGGGGCTGGGAGGGGACAGAGGG + Intronic
969511765 4:7622153-7622175 AGGGGCTGGGTGAGGGGAGAAGG - Intronic
969570843 4:8007347-8007369 AGGGGCTGGGAGAGGATGGATGG - Intronic
969596641 4:8152823-8152845 AGAGTCTTGGTAGGGATTGAGGG - Intronic
970486574 4:16530707-16530729 AGAGTCTCTGTGAGGATAGATGG - Intronic
971005719 4:22372288-22372310 AGGGTCGGGGTGGGGGAACAGGG + Intronic
971372067 4:26027769-26027791 AGAGTCTGGTTGGGGACAGGGGG + Intergenic
971737250 4:30470121-30470143 AGGGTAGGGGCGGGGAGAGAGGG + Intergenic
972900774 4:43680493-43680515 AGGGTTTGGGTGTGGATAAGTGG - Intergenic
973880839 4:55269679-55269701 TGGGTGTGGGTGGGGATGGGAGG - Intergenic
974368966 4:60989113-60989135 AGGGCCTGGGTGAGGATGGGAGG - Intergenic
976599893 4:86928412-86928434 AGGCACTGGGAGGAGATAGAAGG - Intronic
976850660 4:89541677-89541699 AGGGTTTGGGGAGGGATAGTTGG - Intergenic
977515422 4:98016046-98016068 AGGGCCTGTGTGGGGGTGGAAGG + Intronic
977844117 4:101746462-101746484 AGAGTCTGGGTGGAGATAATGGG - Intronic
978485448 4:109248594-109248616 ATGGCATGGGTGGAGATAGATGG - Intronic
978514743 4:109558301-109558323 AGGATGTGGGTGGGGCCAGATGG + Intergenic
980070754 4:128240974-128240996 AGGCTGTGGGTGGGGAATGAAGG + Intergenic
980215007 4:129841251-129841273 GGGGTCAGGGTTGGGATAGTTGG - Intergenic
982678255 4:158400517-158400539 TGGATCTGGGTGGTGGTAGATGG - Intronic
983000770 4:162411118-162411140 AGGGTATGGGAGGGGATGGGAGG - Intergenic
984189191 4:176584398-176584420 AGGGCCTGGGTGTGGCTAGGAGG - Intergenic
985038012 4:185860830-185860852 AGGGTCTGGGTGAAGATAAGAGG + Intronic
985788176 5:1910853-1910875 TGGGAGTGGGTGGGGACAGAGGG + Intergenic
986662267 5:10069737-10069759 AGAGTGTGGTTGGGGAAAGATGG - Intergenic
987001087 5:13660755-13660777 AGTGTCTGGTTGGGAATAAAAGG - Intergenic
987124804 5:14802368-14802390 TGGGTCTGGGAAGTGATAGATGG - Intronic
987666372 5:20946608-20946630 AAGATTTGGGTGGGGATACAGGG - Intergenic
988553479 5:32217256-32217278 AGGGCCTGGGTGTGGGGAGAAGG + Intergenic
988684917 5:33516875-33516897 AGGGTCCGGGTGGGGTCAGTTGG - Intergenic
991726530 5:69541204-69541226 TGGGTGTGGGTGGGTATTGATGG - Intronic
991868427 5:71086670-71086692 TGGGTGTGGGTGGGTATTGATGG + Intergenic
992231849 5:74671522-74671544 AGGGGCAGGGAGGGGAGAGAAGG + Intronic
992252605 5:74890222-74890244 AGGGTGGGGATGGGGGTAGATGG + Intergenic
993451686 5:88078864-88078886 AGGGTCTAGTTGAGGGTAGATGG + Intergenic
997211361 5:132078896-132078918 AGGGGCTGTGTGGTGATGGAAGG - Intergenic
997211430 5:132079292-132079314 AGGGTGTGGGTGGGTATTGGGGG + Intergenic
997586968 5:135049015-135049037 AGGGTGTGGGTGGCTAAAGAGGG - Intronic
998006780 5:138662300-138662322 TGGGTGTGGGTGGGGACAGGGGG + Intronic
998116717 5:139543440-139543462 AGGATCTACGTGGGTATAGAGGG - Intronic
998402733 5:141856309-141856331 AGGGGCGGGGTGGGGGTGGAGGG + Intronic
1000108310 5:158082187-158082209 AGAGTCTGAGTGGGCATAGTTGG + Intergenic
1000872182 5:166590728-166590750 AGGATCTGGGTGGAGAAAGAGGG - Intergenic
1000935817 5:167302469-167302491 GGGGTCAGGGTGGGGAAATAAGG + Intronic
1001004469 5:168038332-168038354 AGGATCTGGGTGGGGGTAACCGG - Intronic
1001176202 5:169471179-169471201 AGAGCCTGGGTTGGGATGGAGGG - Intergenic
1001529639 5:172453381-172453403 AGGTTCTAGGTGGAGATAAAGGG - Intronic
1001649007 5:173302123-173302145 AGGGTCTGGGTGGGATTTGGTGG + Intergenic
1001763369 5:174225422-174225444 AGGGTCTGGGTGTGGACGTAGGG + Intronic
1001897952 5:175397489-175397511 ATGGTCGGGGTGGGGGAAGACGG - Intergenic
1001979827 5:176030883-176030905 AGGGTGTGGGTGGGGATGTGAGG + Intronic
1001979900 5:176031077-176031099 AGGGTGTGGGTGGGGATGTGAGG + Intronic
1002237478 5:177812588-177812610 AGGGTGTGGGTGGGGATGTGAGG - Intergenic
1002463230 5:179387323-179387345 AGGGGCTGTGTGGGGAGGGAAGG - Intergenic
1002784820 6:392774-392796 GGCGGCTGGGTGGGGAGAGAGGG + Intronic
1003860666 6:10319382-10319404 AGGTTTTCCGTGGGGATAGAGGG + Intergenic
1003935364 6:10970355-10970377 AGGGTGTGGGTGTGGATGGTGGG + Intronic
1004045250 6:12017570-12017592 AGGATGTGGGTGGGGCCAGACGG - Intronic
1005677600 6:28171310-28171332 AAGGGCTGGGAGGGGAAAGAGGG - Intergenic
1005979336 6:30824424-30824446 AGGGACTGAGTGGGGACAGATGG + Intergenic
1006300423 6:33191064-33191086 AGGGGCTGAGTGGGTAGAGATGG - Intronic
1006740428 6:36304133-36304155 ATGGTCTGGGTGGAGACAGAGGG + Intronic
1006811331 6:36822279-36822301 TGGATCTGGGTAGGGGTAGAGGG + Intronic
1007289984 6:40778316-40778338 AAGGCCTGGGCGGGGATAGGAGG + Intergenic
1007382464 6:41499601-41499623 GGGGTCTGTGTTGGGGTAGAAGG - Intergenic
1007397307 6:41585259-41585281 AGGGTCTGGGTGCGGAGGGAGGG - Intronic
1007745248 6:44039537-44039559 AGGGTCTGGTTGAAGATGGAGGG - Intergenic
1007947806 6:45841470-45841492 GGGGTCGGGGTGGGGGAAGAAGG + Intergenic
1008209401 6:48702368-48702390 GGGGTCTTAGTGGGGATGGAGGG + Intergenic
1009465977 6:63970005-63970027 GGGGTCTGGGTGTGGAGATAGGG - Intronic
1009866719 6:69406998-69407020 ATGGGCTGGGTAGGGGTAGATGG + Intergenic
1011055449 6:83199123-83199145 AGGTTCTGAGAGGGGATGGATGG - Intergenic
1011227202 6:85120401-85120423 TGGGTCTGGGTGGGAAGAGGAGG - Intergenic
1013354234 6:109333097-109333119 AGAGACTGGGTGGGGCAAGAAGG + Intergenic
1015391347 6:132685941-132685963 AAGGTGTGGGTGGGGGTGGAGGG - Intronic
1016260816 6:142167823-142167845 AGGGAATGGGTTGGGGTAGAAGG + Intronic
1016310908 6:142732334-142732356 AGGGAGTGGGTGGGGATAAGAGG + Intergenic
1018742052 6:166736998-166737020 AGGGGCTGGGAGGGGAGAAAAGG + Intronic
1018834601 6:167473537-167473559 TGGGTCTGGTTTGGGAAAGAGGG + Intergenic
1019069941 6:169337017-169337039 AAAGTCTGGGTGGTGTTAGAGGG + Intergenic
1019427456 7:984310-984332 TGGGTAGGGGTGGGGACAGAGGG - Intronic
1021231044 7:18086716-18086738 CGGGGCTGGGTGGGGATAGGAGG - Intergenic
1021845642 7:24759757-24759779 ATGGTCTGTGTTGGGAGAGAGGG + Intergenic
1022399444 7:30023486-30023508 AGGGTCTGAGTGGGGATTTAGGG - Intronic
1022642860 7:32204715-32204737 AGGGTCTGAATGGGGATAATAGG - Intronic
1023272041 7:38474089-38474111 AGGGTTAGGGTGGGGACAGTGGG + Intronic
1024906792 7:54392300-54392322 AATGTCTGGGTGGTGCTAGAGGG + Intergenic
1025002038 7:55324430-55324452 AGGGTGCGGGTGGGGTGAGAAGG - Intergenic
1025183476 7:56837679-56837701 AGGGTCGTGGTGGTGAGAGATGG - Intergenic
1025185565 7:56855737-56855759 AGGGTCGTGGTGGTGAGAGATGG - Intergenic
1025688449 7:63739288-63739310 AGGGTCGTGGTGGTGAGAGATGG + Intergenic
1027002440 7:74662905-74662927 AGGGTGTAGGTGGGGAAAGGAGG - Intronic
1027053127 7:75032178-75032200 AAGGTCTGGGTGGGGATGCTGGG - Intronic
1027268994 7:76510228-76510250 TGACTCTGGGTGGGGACAGAAGG + Intergenic
1027269324 7:76511452-76511474 TGGCTCTGGGTGGGGACAAAAGG + Intronic
1027320035 7:77005347-77005369 TGGCTCTGGGTGGGGACAAAAGG + Intergenic
1027732428 7:81891789-81891811 AGGGGCTGGTGGGGGAGAGATGG + Intergenic
1029174915 7:98657847-98657869 AGGGTCGGGGCGAGGACAGAGGG - Intergenic
1029628272 7:101734076-101734098 GGGGTGAGGGTGGGGATAGTGGG - Intergenic
1030240444 7:107317261-107317283 CTGTTCTGGGAGGGGATAGAAGG - Intronic
1032085248 7:128880335-128880357 AGGGTCAGGGTGGGGGCACATGG - Intronic
1032388051 7:131538192-131538214 AGGGTCTGCCTGGGGGTAGGGGG - Intronic
1034534916 7:151720682-151720704 AGGGGATGGATGGGGACAGAGGG + Intronic
1034534981 7:151720879-151720901 AGGGGATGGTTGGGGACAGAGGG + Intronic
1034962862 7:155373353-155373375 AGGGACTGTGTGGGGGAAGAAGG - Intergenic
1034979932 7:155469110-155469132 AGGGGCTGGGTGGGGAGATGGGG - Intergenic
1035563907 8:628717-628739 AGGGTATGGGTGGGGATGAGGGG - Intronic
1035572486 8:682026-682048 AGGGGCAGGGTGGGGGTGGATGG - Intronic
1035600645 8:894937-894959 AGGGGCGGGGTGGGGAAAGTGGG + Intergenic
1035776783 8:2194147-2194169 AGGGCCTGGCTGGGGGTGGATGG + Intergenic
1037181715 8:16014858-16014880 AGTGTCTGAGTGGACATAGAGGG + Intergenic
1038036670 8:23691824-23691846 AGGGGCTGGGGGAGGAAAGAAGG + Intergenic
1038075848 8:24072653-24072675 TGGGATTGGGTGGGAATAGAGGG + Intergenic
1038350436 8:26771469-26771491 AGGGTTTGGGTAGGTAGAGAAGG - Intronic
1038446255 8:27606305-27606327 AGGCTCTGAGTGGGGAAGGAGGG - Intronic
1038546061 8:28426620-28426642 TGGGTCTGGGTGGGGAGGGTGGG - Intronic
1038884321 8:31646855-31646877 AGGCTCTGGATGGGAAGAGAAGG - Intronic
1039078244 8:33711581-33711603 ATGGTAGGGGTGGGGATAGGAGG - Intergenic
1039392154 8:37189971-37189993 AGGGGACGGGAGGGGATAGAGGG + Intergenic
1039501236 8:38019158-38019180 AGCAGGTGGGTGGGGATAGAGGG - Intergenic
1040575808 8:48650228-48650250 AGGGGCAGGGTGGGGAGAGCAGG + Intergenic
1040917505 8:52578428-52578450 AGGGAATGGGTGGGAATATAAGG - Intergenic
1041106847 8:54453300-54453322 AGGGTGTGGATGGGGAAAGTGGG + Intergenic
1041368624 8:57135378-57135400 AGAGTTTGGGTGGGAAAAGAAGG - Intergenic
1042837667 8:73092722-73092744 TGGGGATGGGTGGGGATAAAGGG + Intronic
1042884501 8:73532888-73532910 AGGGGCTGGGTGGGGAGTGGAGG - Intronic
1044190503 8:89310843-89310865 ATGATTGGGGTGGGGATAGATGG - Intergenic
1044328901 8:90893233-90893255 GGGGTGTCGGTGGGGGTAGAGGG + Intronic
1047231600 8:123002310-123002332 AGGGCCGGGGTGGGGAGTGAGGG + Intergenic
1047514445 8:125541401-125541423 AGGATGGGGGTGGGGATGGAAGG + Intergenic
1047702387 8:127462073-127462095 GGGGGCTGGGTGGGGATAGGAGG + Intergenic
1048182496 8:132208939-132208961 AGGGTCTGGGAGGGGGAAGCAGG + Intronic
1048280404 8:133101515-133101537 AGGGGCTGGGTGGGTATCAAAGG - Intronic
1049408742 8:142463184-142463206 AGGGCCTGGGGAGGGATGGAGGG - Intronic
1049426168 8:142538790-142538812 AGGGTCTGGGGAGGGAGAGGTGG - Intronic
1050637967 9:7632493-7632515 GGGGTCTGTTGGGGGATAGAGGG + Intergenic
1051994198 9:23194555-23194577 CGGGTGTGGGTGGGGGAAGAGGG + Intergenic
1053163924 9:35831459-35831481 AGGCACTGGCTGGGGATGGATGG - Intronic
1055426708 9:76204194-76204216 ACGGTCATGGTGGGGATAGAGGG - Intronic
1056693170 9:88825238-88825260 AAGGCCTGGGTGGAGAAAGAAGG + Intergenic
1056796274 9:89660850-89660872 AGGGTGGGGGTGGGGATTGTGGG + Intergenic
1056834396 9:89942896-89942918 CGGGGCTGGCTGTGGATAGATGG + Intergenic
1057725251 9:97563895-97563917 AGGGGCTGGGTGGGGGTAGGGGG - Intronic
1058741151 9:107944068-107944090 AGGGTCTGGCTTGGGAAAGTGGG + Intergenic
1061227834 9:129291029-129291051 CGGGTCTGGGTGGGAGTAGGTGG - Intergenic
1061382615 9:130267309-130267331 AGGCTCTCGGTGGGCATAGGCGG - Intergenic
1061853527 9:133429360-133429382 AGGGGCGGGATGGGGATGGACGG - Intronic
1061870922 9:133520061-133520083 TGGGAGTGAGTGGGGATAGAGGG + Intronic
1062032802 9:134369627-134369649 AGGCCCTGGGTGGGGCTGGAGGG - Intronic
1062318519 9:135979466-135979488 AGGGTCTGGCTGAGGAAGGAAGG - Intergenic
1062328484 9:136024228-136024250 AGGGTGTGTGTGAGGACAGAGGG + Intronic
1062328487 9:136024247-136024269 AGGGTGTGTGTGAGGACAGAGGG + Intronic
1062328490 9:136024266-136024288 AGGGTGTGTGTGAGGACAGAGGG + Intronic
1062328508 9:136024449-136024471 AGGGTATGTGTGAGGACAGAGGG + Intronic
1185511774 X:669134-669156 AGGGCCTGTGGGGGGATAGAAGG - Intergenic
1186310827 X:8316860-8316882 AAGGACTGACTGGGGATAGACGG - Intergenic
1188330239 X:28861710-28861732 AGGGTATGTGTGAGGAGAGATGG - Intronic
1189484660 X:41420968-41420990 AGGGACTGGGTGGGATTTGATGG + Intergenic
1189697569 X:43680547-43680569 AGGGAATGGGAGGGGATGGAGGG - Intronic
1190054782 X:47175216-47175238 AGGGTCAGGAAGGGGAGAGAGGG - Intronic
1190132157 X:47758451-47758473 AGGGTCTTGGTGGGGATAGCTGG + Intergenic
1190175910 X:48149175-48149197 AGGGTGTGGGGGGGGGCAGAGGG + Intergenic
1190863348 X:54363860-54363882 TGGGTCGGGGTGGGGGAAGAGGG + Intergenic
1191783748 X:64895422-64895444 AGGATCTAGGTGGGAATATATGG - Intergenic
1191911112 X:66151268-66151290 AGAGTCTGGGGTGGGGTAGAGGG - Intergenic
1192539177 X:71953903-71953925 AGGTGCAGGCTGGGGATAGAAGG - Intergenic
1192891790 X:75398672-75398694 AGAGCTTGGGTGGGGATAGCTGG - Intronic
1194430629 X:93799617-93799639 CAGGTTTGGGTGGGGATAAATGG + Intergenic
1194634480 X:96327618-96327640 TGGCTCTGGGTAGGGATGGAGGG - Intergenic
1195000594 X:100639621-100639643 AGGGGCTTGGTAGGGATGGAGGG - Intronic
1196264180 X:113622240-113622262 AGGGTCAGGGAGGGGGTGGAAGG + Intergenic
1196606739 X:117665692-117665714 AGGGCCTGTTTGGGGGTAGAGGG - Intergenic
1197732841 X:129826750-129826772 GGGGTGAGGGTGGGGATAGTGGG - Intronic
1197996876 X:132386807-132386829 AGGGCCTGTGGGGGGAGAGATGG + Exonic
1198183992 X:134236746-134236768 AGGGTGTGCGTGGGGATGGAGGG + Intergenic
1198443889 X:136692063-136692085 AGAGTGTGGGTGGGGATTGCAGG - Intronic
1198653947 X:138893226-138893248 AGGATCTGGGTGTGGGTACAGGG - Intronic
1198933365 X:141882207-141882229 AGGGCCCGGGTGGGGCTTGAGGG + Intronic
1199336770 X:146627803-146627825 AATGTCTGGGTGGTGATAAAAGG - Intergenic
1199426276 X:147704468-147704490 AGGGTCGGGGTGGGGGTGGCAGG - Intergenic
1200226165 X:154419068-154419090 AGGGCCTGGCTGGGGAGGGAGGG + Intronic