ID: 905409061

View in Genome Browser
Species Human (GRCh38)
Location 1:37755829-37755851
Sequence CCTACCTCTCAGAACTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 173}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905409049_905409061 23 Left 905409049 1:37755783-37755805 CCACTTTAAAAAAATTTCTCACC 0: 1
1: 0
2: 4
3: 35
4: 450
Right 905409061 1:37755829-37755851 CCTACCTCTCAGAACTTGGGTGG 0: 1
1: 0
2: 0
3: 6
4: 173
905409055_905409061 -7 Left 905409055 1:37755813-37755835 CCAGTTGGTTCCTGGCCCTACCT 0: 1
1: 0
2: 1
3: 5
4: 150
Right 905409061 1:37755829-37755851 CCTACCTCTCAGAACTTGGGTGG 0: 1
1: 0
2: 0
3: 6
4: 173
905409048_905409061 24 Left 905409048 1:37755782-37755804 CCCACTTTAAAAAAATTTCTCAC 0: 1
1: 0
2: 6
3: 58
4: 571
Right 905409061 1:37755829-37755851 CCTACCTCTCAGAACTTGGGTGG 0: 1
1: 0
2: 0
3: 6
4: 173
905409053_905409061 2 Left 905409053 1:37755804-37755826 CCAGCTGGGCCAGTTGGTTCCTG 0: 1
1: 0
2: 0
3: 21
4: 306
Right 905409061 1:37755829-37755851 CCTACCTCTCAGAACTTGGGTGG 0: 1
1: 0
2: 0
3: 6
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905409061 Original CRISPR CCTACCTCTCAGAACTTGGG TGG Intronic
903305387 1:22409265-22409287 TCTACCCCTCAGGACTTGGCAGG + Intergenic
903354310 1:22736862-22736884 CCTCCCTGTCAGACCTGGGGAGG + Intronic
903524899 1:23986257-23986279 CCTACCTGTTAATACTTGGGAGG - Intergenic
904513819 1:31037460-31037482 CATGCCTCCCAGCACTTGGGAGG + Intronic
905256196 1:36687016-36687038 CCTACCTCTCATAACTGGTCTGG + Intergenic
905409061 1:37755829-37755851 CCTACCTCTCAGAACTTGGGTGG + Intronic
907757852 1:57328156-57328178 CCCACCTCTCAGAAGCTAGGTGG - Intronic
909549535 1:76882431-76882453 ATTACATCTCAGAATTTGGGGGG - Intronic
909907469 1:81216226-81216248 CCTATTTCTCAGAACTTTTGTGG - Intergenic
911159256 1:94668025-94668047 GCGGCCTCCCAGAACTTGGGAGG - Intergenic
912751647 1:112293190-112293212 CCCACCTCTCAGACGATGGGCGG - Intergenic
913993717 1:143637684-143637706 CCCACCTCTCAGACGATGGGCGG - Intergenic
916036275 1:160925347-160925369 CCTTTCTCTGAGCACTTGGGAGG - Intergenic
918080463 1:181204017-181204039 CCTGCCTCTGAGTTCTTGGGAGG - Intergenic
920422853 1:205847247-205847269 CCCACCTCTGACAACTTTGGAGG + Intronic
920423603 1:205854490-205854512 CCCACCTCTGACAACTTTGGAGG - Intergenic
921630821 1:217431650-217431672 CCTATCTCACAGAACTTTGTAGG + Intronic
922991079 1:229912087-229912109 CTTAGCACTCAGCACTTGGGAGG + Intergenic
923561821 1:235047459-235047481 CCTCCCTCCCAGAGCTTGCGGGG + Intergenic
1063750026 10:8933796-8933818 CCTACCTCACAGCCCTTGGAGGG - Intergenic
1067034117 10:42900356-42900378 CCTACATCTCAGACGATGGGCGG - Intergenic
1073357836 10:102870985-102871007 CCGTCATCCCAGAACTTGGGAGG + Intronic
1075137244 10:119795462-119795484 CCCACCTCTCAGACGATGGGCGG + Intronic
1075407341 10:122203582-122203604 CCCACATCTCAGAAGATGGGCGG + Intronic
1075417653 10:122277108-122277130 ACTACCTCTGAGAATGTGGGTGG + Intronic
1075505921 10:123022215-123022237 CCTTTCTCTGAGAACCTGGGAGG - Intronic
1076732398 10:132445261-132445283 GCTACCTCTCAGCTCCTGGGAGG - Exonic
1079569616 11:21926360-21926382 CCCACCTCTCAGGACTGTGGGGG - Intergenic
1081992820 11:47346842-47346864 CCTATCTGTCAGAGCTTAGGAGG - Intronic
1082678793 11:56143717-56143739 CCCACATCTCAGAAGATGGGCGG - Intergenic
1082775023 11:57237845-57237867 CCTCCCTCTGAGAACTTTTGTGG + Intergenic
1083091267 11:60201535-60201557 CCCACATCTCAGAAGATGGGCGG + Intronic
1083979897 11:66158577-66158599 CCTAGTTCTAAGTACTTGGGTGG + Intronic
1084070353 11:66729291-66729313 CCTACTTCTCAGAGCTGGAGTGG - Intergenic
1084449951 11:69230786-69230808 CCTGGCCCTCAGAACCTGGGAGG - Intergenic
1086017171 11:82181814-82181836 CCCACATCTCAGACCATGGGCGG - Intergenic
1087273377 11:96135771-96135793 CATACATCTCTGAACCTGGGAGG + Intronic
1087672356 11:101122788-101122810 CCTCCCTCTCCTAACATGGGAGG + Intronic
1089767039 11:120775449-120775471 CCTACCTCTCAGACCTTACAGGG + Intronic
1090639498 11:128718206-128718228 CCTACCTCTCAGCATTTGAATGG - Intronic
1091021142 11:132101146-132101168 CCTACCTCTATGGACTTGAGTGG + Intronic
1092850045 12:12618455-12618477 CCCACATCTCAGACGTTGGGCGG + Intronic
1094044259 12:26149982-26150004 CCTACCTTTCAGAAGATGTGAGG - Intronic
1097228666 12:57495425-57495447 CCCACATCTCAGACCATGGGCGG + Intronic
1097254298 12:57660651-57660673 CCTTTCTCTGAGCACTTGGGAGG + Intergenic
1098342942 12:69470505-69470527 GCTCCCTCTCAGCACCTGGGCGG + Exonic
1100333236 12:93605398-93605420 ATTACCTGTCAGAAATTGGGTGG + Intergenic
1102012756 12:109628677-109628699 CCCACCTCACAGAGCCTGGGGGG + Intergenic
1103001098 12:117385908-117385930 GCTACCTCTCAGGTGTTGGGGGG + Intronic
1103299937 12:119919120-119919142 CCCACATCTCAGAATATGGGCGG + Intergenic
1104454415 12:128898973-128898995 CCTGCCTCTCTGAACTTGCGTGG + Intronic
1104559711 12:129832749-129832771 CCTTCCTCTCAGATCATGGCCGG - Intronic
1104597935 12:130132657-130132679 CCTCCTTCCCAGAACATGGGTGG + Intergenic
1105976866 13:25480540-25480562 CCCACATCTCAGAAGATGGGCGG + Intronic
1106670842 13:31903352-31903374 CCAAACTCCCAGACCTTGGGAGG - Intergenic
1120612414 14:86658355-86658377 CCTGCCTCCCAGAACTTCAGTGG - Intergenic
1122592040 14:102860586-102860608 CCTTTCTCTCAGCACCTGGGAGG - Intronic
1123076755 14:105671301-105671323 CCTACCTGTAGGAAATTGGGGGG + Intergenic
1124744312 15:32326332-32326354 CCTCCCACTCAGGAATTGGGTGG - Intergenic
1125221037 15:37335777-37335799 CCTACTTCTGAGAAGTTGGCAGG + Intergenic
1125651416 15:41320894-41320916 CCCACATCTCAGACCATGGGAGG - Intronic
1131564062 15:93470008-93470030 CCTAGCTCTTAGAACTGGGCAGG + Intergenic
1135729454 16:24882178-24882200 CCTACCACGTAGAACTTGGTGGG + Intronic
1137522038 16:49202746-49202768 CCTTCCTCTGAGGACATGGGAGG + Intergenic
1139864141 16:70050935-70050957 CCCACCTCTCAGACGATGGGCGG - Intergenic
1140934526 16:79658179-79658201 CCTAACTCTCAGTACCTGGATGG - Intergenic
1141633307 16:85300896-85300918 CCTGCCTCCCAGAATTTGGGGGG + Intergenic
1143689612 17:8550299-8550321 CCCACATCTCAGAAGATGGGCGG - Intronic
1145174076 17:20684975-20684997 CCCACATCTCAGACCATGGGCGG - Intergenic
1150287813 17:63963796-63963818 CCCACCTTCCAGAGCTTGGGCGG + Exonic
1152774981 17:82195418-82195440 CCCACCTCCCAGGACGTGGGTGG - Intronic
1154943558 18:21138016-21138038 CCCACCTCCCAGACGTTGGGCGG + Intergenic
1156338408 18:36188960-36188982 CCTACCACTCAGAAATAGAGGGG + Intronic
1157432991 18:47644927-47644949 CCTACCTCTCTGGAGGTGGGAGG - Intergenic
1159549971 18:69884613-69884635 CTACCCTCTCAGAAATTGGGAGG - Intronic
1160138672 18:76298133-76298155 CCAACTTCTCTGAACCTGGGTGG + Intergenic
1165083386 19:33324888-33324910 CCTACGTCTAAAAACTTGGCTGG + Intergenic
1167332859 19:48867241-48867263 ACTACTTCTCAGAACTCGAGGGG + Intronic
1167829522 19:52008136-52008158 CTTACTTCCCAGAACTTGGTGGG + Exonic
924970908 2:126776-126798 CCCACCTCTCAGACGATGGGCGG - Intergenic
928558159 2:32448038-32448060 CCCACCTCTCAGACGATGGGCGG + Intronic
929650849 2:43678134-43678156 CCCACATCTCAGAAGATGGGTGG + Intronic
929798866 2:45082587-45082609 CCTTCCTCTCAGGTCCTGGGGGG + Intergenic
930396424 2:50828613-50828635 CCCACATCTCAGAAGATGGGTGG + Intronic
931189736 2:59988561-59988583 CCCACCTCTCAGAACCTCAGAGG - Intergenic
935311785 2:101791212-101791234 CCAACCTCTGGGAACTTGGCTGG - Intronic
937260716 2:120585452-120585474 CCTCCCTCTCAGAAGATTGGGGG - Intergenic
938087269 2:128409706-128409728 CCTCCCTCTCAGGACTGGTGAGG - Intergenic
938278813 2:130050665-130050687 CCTGCCTCTCAGAGGGTGGGTGG - Intergenic
938533750 2:132220973-132220995 CCCACCTCTCAGACGATGGGCGG - Intronic
939230385 2:139417326-139417348 CCTCACTCTGAGAACTTGGTAGG + Intergenic
939246845 2:139636161-139636183 CCTACCTTTCTGAAATTTGGGGG + Intergenic
940567770 2:155389691-155389713 CCTATGTCTCAAAACTTAGGGGG + Intergenic
941084724 2:161104102-161104124 CCTGCCTCTCAGCCCTGGGGTGG + Intergenic
941852735 2:170200433-170200455 CCTACCTGTAAGAACTGTGGAGG - Intronic
942964622 2:181876593-181876615 CCTACCTCTCTGAGCTTGATGGG - Intergenic
946646926 2:221847273-221847295 CCTACTTCATAGAATTTGGGGGG + Intergenic
946751515 2:222897309-222897331 CCCACCTCTCAGACGATGGGCGG + Intronic
948000408 2:234562777-234562799 CCCACCTCTCAGACGATGGGCGG - Intergenic
1169486080 20:6033973-6033995 CCTACCTGTCAAACCTTGTGAGG - Intronic
1170039188 20:12022515-12022537 CAGACATCTCAGAAGTTGGGTGG + Intergenic
1170209478 20:13834415-13834437 CCTACCTATTAATACTTGGGAGG - Intergenic
1170443319 20:16399982-16400004 CTGACCTCTCAGAAATTGGCTGG - Intronic
1177153140 21:17474883-17474905 CTTACATCTCAGAACTGGAGGGG + Intergenic
1177788353 21:25695852-25695874 CCCACATCTCAGAAGATGGGCGG + Intronic
1178361679 21:31953695-31953717 CCTACCTCTCAGATCGTATGAGG - Intronic
1179969126 21:44824693-44824715 CCCACATCTCAGAAGATGGGCGG - Intergenic
1181902315 22:26166887-26166909 CCTACTTCCCAGAAATTTGGTGG - Intergenic
1184271697 22:43388082-43388104 CCTACCTTGCAGAACTGGTGAGG + Intergenic
1184516099 22:44963768-44963790 CCTGCTTCTCCGAACTTTGGTGG - Intronic
1184573870 22:45346413-45346435 CAAACCACTCAGAACTTGGACGG + Intronic
949866735 3:8553275-8553297 CCTTCCTCTGAGTCCTTGGGAGG + Intronic
950569648 3:13792120-13792142 CCTGTGTCTCAGACCTTGGGAGG + Intergenic
954688327 3:52382635-52382657 CCAACCTCTCAGAGCTAAGGTGG + Intronic
959156877 3:102677686-102677708 TCCACCTCTCAGAACTCGTGAGG + Intergenic
962480748 3:135796177-135796199 GCTACCTCTCAGGGTTTGGGGGG - Intergenic
965616351 3:170596711-170596733 CCCACCTTCCAGAACTTTGGTGG - Intronic
966783801 3:183607947-183607969 CCCACCTCTCAGACGATGGGCGG - Intergenic
967976221 3:195036065-195036087 ACCACCTCTCTGACCTTGGGCGG - Intergenic
968226191 3:196973769-196973791 CCCACATCTCAGACGTTGGGCGG - Intergenic
970345838 4:15151183-15151205 CCAACCTCACAGAACAAGGGAGG - Intergenic
971253531 4:24993098-24993120 CCTGCCTCACAGAATTTGTGAGG + Intergenic
971522105 4:27566976-27566998 CTTGCCTCTCTGAACTTGGGGGG + Intergenic
976266039 4:83186390-83186412 CCCACCTCTCAGACGATGGGCGG + Intergenic
977732173 4:100366781-100366803 CCTGCCTTTCAGAACTTTAGAGG - Intergenic
978767064 4:112415071-112415093 CCTCCATCCCAGAGCTTGGGCGG - Intronic
980572449 4:134638057-134638079 CCTTCCTCTCAGCCCTTGGAAGG + Intergenic
982089016 4:151864344-151864366 CCTATCTCTCAGAGGTTTGGAGG + Intergenic
982902131 4:161019968-161019990 CCAACTTCTCACATCTTGGGAGG + Intergenic
985695946 5:1340180-1340202 CCCACTTCTCAGAAGTTGAGAGG + Intronic
988832646 5:35002901-35002923 CCTGCCTCTCACAACTTCAGTGG - Intronic
989156632 5:38350763-38350785 CCGCCCTCTCAGAACTTAGTGGG + Intronic
989588048 5:43088505-43088527 CCCACCTCTCAGACGATGGGCGG + Intronic
991597935 5:68323938-68323960 CCCACATCTCAGAAGATGGGCGG + Intergenic
991925528 5:71701897-71701919 TCTACCACTCAGAAGTTGTGTGG + Intergenic
999065493 5:148681330-148681352 TCTAGCTTTCAGAACATGGGAGG + Intergenic
1000261080 5:159589168-159589190 CCTAACACTGGGAACTTGGGTGG + Intergenic
1003652698 6:7975987-7976009 CCTGCCTCTCAGCACCTGCGTGG + Intronic
1004151336 6:13123063-13123085 TGTGGCTCTCAGAACTTGGGAGG + Intronic
1005683890 6:28233209-28233231 CCTGCCCCACACAACTTGGGTGG - Exonic
1011588034 6:88947255-88947277 CCCACATCTCAGAATATGGGCGG - Intronic
1011588182 6:88947706-88947728 CCCACATCTCAGAATATGGGCGG - Intronic
1013638055 6:112047680-112047702 CCCACATCTCAGAAGATGGGCGG - Intergenic
1015377502 6:132527396-132527418 CCTTTCTCTGAGGACTTGGGAGG + Intergenic
1020447169 7:8281207-8281229 GCTAGCTCTTAGAACTGGGGTGG - Intergenic
1022005351 7:26261876-26261898 CCCACATCTCAGAAGATGGGCGG - Intergenic
1024587404 7:50853933-50853955 AATACCTCTGAAAACTTGGGAGG - Intergenic
1026375956 7:69751246-69751268 CAAACCTCTCAGACCCTGGGTGG - Intronic
1033382013 7:140830644-140830666 CCAACCTCTGAGAAGTGGGGAGG + Intronic
1034260120 7:149749999-149750021 CCCACCTCTTAAACCTTGGGGGG + Intergenic
1034961900 7:155367974-155367996 CCCACCTCTCAGACGATGGGCGG + Intergenic
1037134638 8:15446191-15446213 CCCACATCTCAGACGTTGGGTGG + Intronic
1038469804 8:27805606-27805628 CCTACCACCCAGATCTTGGTTGG + Intronic
1038670049 8:29575735-29575757 CCTACCACTCAATACTTGGGAGG - Intergenic
1045195609 8:99927190-99927212 CCCACATCTCAGAAGATGGGTGG - Intergenic
1048884905 8:138902118-138902140 CTCACCTCTCCCAACTTGGGAGG - Intronic
1050464438 9:5906675-5906697 CCTACCTCTCAGAATTGCTGTGG - Intronic
1053457138 9:38241842-38241864 CCCACATCTCAGACCATGGGCGG - Intergenic
1053495083 9:38543851-38543873 CCGGCCTCTCAGAGCGTGGGTGG - Intronic
1055932493 9:81573843-81573865 TCTTGCTCTCAGATCTTGGGGGG - Intergenic
1060899407 9:127244497-127244519 CCTAGATCTCAGAATTTTGGAGG - Intronic
1061022003 9:128021980-128022002 CATACCTCCCAACACTTGGGAGG - Intergenic
1061168902 9:128940698-128940720 CCTACCTCTCTGCACTGGGGTGG - Exonic
1061189340 9:129072473-129072495 CCTGGCTCTCACAGCTTGGGGGG - Intergenic
1061705556 9:132450502-132450524 CCTATCTCACAGAAGTTTGGTGG - Intronic
1062389046 9:136326916-136326938 CCCACCTCTGAGACCCTGGGTGG - Intergenic
1186213459 X:7274209-7274231 ACTACTTCTGTGAACTTGGGTGG - Intronic
1186923007 X:14302884-14302906 CCCACCTCTCAGACGATGGGCGG + Intergenic
1188861593 X:35263456-35263478 CCTATCTGGCAGAACTTGAGAGG + Intergenic
1189005830 X:36993703-36993725 CCAAGCTCTCACAACTTTGGGGG + Intergenic
1189216705 X:39331401-39331423 ACTTCCTCTCCAAACTTGGGTGG - Intergenic
1189570076 X:42286004-42286026 CCCACATCTCAGAGGTTGGGAGG + Intergenic
1189838112 X:45041636-45041658 CCCACCTCTCAGACGATGGGCGG + Intronic
1192206753 X:69101411-69101433 CCTACATGTTAGAAGTTGGGGGG + Intergenic
1193028192 X:76868473-76868495 CCTTCCTCTCAGACCTTAGTAGG + Intergenic
1196085885 X:111681736-111681758 CCTTCCCCTCAGCACTTGGCCGG + Intronic
1196162233 X:112498741-112498763 CCTTCCTCTGAGCACCTGGGAGG - Intergenic
1196616205 X:117769395-117769417 CCTACTCCTCAGCCCTTGGGCGG - Intergenic
1197856392 X:130918012-130918034 CCTGCCTCACAGAAGTTGGAAGG - Intergenic
1199058547 X:143326932-143326954 CCTACCCGTCAGAATTTGGGGGG - Intergenic