ID: 905409205

View in Genome Browser
Species Human (GRCh38)
Location 1:37756653-37756675
Sequence CTGCCAGCATTGTTCAACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 104}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905409205_905409206 -8 Left 905409205 1:37756653-37756675 CCTTTGTTGAACAATGCTGGCAG 0: 1
1: 0
2: 2
3: 13
4: 104
Right 905409206 1:37756668-37756690 GCTGGCAGAAAGTGCTTCTTAGG 0: 1
1: 0
2: 2
3: 23
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905409205 Original CRISPR CTGCCAGCATTGTTCAACAA AGG (reversed) Intronic
905409205 1:37756653-37756675 CTGCCAGCATTGTTCAACAAAGG - Intronic
915559284 1:156677049-156677071 CCGCCAGCGTTGGTCAACGAGGG + Exonic
918022064 1:180703584-180703606 CTGGCAGCAGTGGTGAACAAGGG + Intronic
918373678 1:183887081-183887103 ATGGGAGCATGGTTCAACAAAGG - Intronic
920208501 1:204311185-204311207 CTAACAGCACTCTTCAACAATGG - Intronic
924291891 1:242545349-242545371 CTGCCAGTATTATTAAACATGGG - Intergenic
1068882893 10:62068567-62068589 CTGCCAGCGGAGTTCACCAAGGG - Intronic
1070921740 10:80191546-80191568 CAGCCAGCTTTCTTCAACAAGGG + Intronic
1078307011 11:10199462-10199484 CTGACAGACTTGTTCAACATTGG + Intronic
1081049495 11:38320025-38320047 ATGCAAGAATTGTTCAACATAGG + Intergenic
1081417938 11:42838149-42838171 CTGCCAACATTGATAAACCATGG - Intergenic
1082175755 11:49057090-49057112 CTGGCAGCATTGTCCAGCAAAGG + Intronic
1082185236 11:49171732-49171754 CTGCCAGAATTAATCAACAAGGG + Intronic
1086616733 11:88830702-88830724 CTGACAGCATGGCTCAAGAAAGG + Intronic
1086681093 11:89673611-89673633 CTGCCAGAATTAATCAACAAGGG - Intergenic
1086689987 11:89778979-89779001 CTGGCAGCGTTGTTCAGCAAAGG - Intergenic
1086698673 11:89873991-89874013 CTGGCAGCACTGTCCAGCAAAGG + Intronic
1086707497 11:89970510-89970532 CTGGCAGCACTGTCCAGCAAAGG - Intronic
1086715867 11:90060976-90060998 CTGGCAGCGTTGTTCAGCAAAGG + Intergenic
1086826505 11:91505717-91505739 CCTCCAGCTTTGTTCAGCAATGG - Intergenic
1086918200 11:92555666-92555688 CTGCCAGGATTAGTCAACACAGG - Intronic
1091736926 12:2930198-2930220 CTGCCAACACTGTTTAAAAAAGG - Intronic
1092670899 12:10859290-10859312 CTGGCAGCATTATTCACCACAGG + Intronic
1094622145 12:32089946-32089968 CTGCTAGCATGATTCAAGAATGG - Intergenic
1098184220 12:67879136-67879158 CAGCCAACAATGTTCAACAATGG + Intergenic
1101855476 12:108439296-108439318 CAGCCAGCATTGTTGCACACTGG - Intergenic
1111650540 13:91085401-91085423 GTCCCAGCATTGTTTAACATAGG + Intergenic
1112069476 13:95832991-95833013 CTGCCAGAATTGTCCCAGAATGG - Exonic
1113595731 13:111530481-111530503 CTACCAGCTTTGCTCACCAAGGG + Intergenic
1117283955 14:54267982-54268004 CTGGCTGGATTGTTCAAGAAGGG + Intergenic
1118475853 14:66116316-66116338 CTGAAAGGATTTTTCAACAAGGG - Intergenic
1120958595 14:90104591-90104613 CTGCCAGAATTGTCTCACAAAGG + Intronic
1121162368 14:91755731-91755753 CTGCCAGCTTTGTTTAAAAAGGG - Intronic
1121845564 14:97169313-97169335 CTGCCTGCTTTTTGCAACAAAGG - Intergenic
1122875320 14:104661411-104661433 CTTGCAGCAGTGTTTAACAAAGG - Intergenic
1124007381 15:25805355-25805377 CTGCCTTCATTGTTGAAAAAAGG + Intronic
1126368747 15:47923199-47923221 CTGCCAGCATTTATCATCATTGG - Intergenic
1127420668 15:58802447-58802469 CTGGCAGCATTTTTCTATAAAGG + Intronic
1129207716 15:74046936-74046958 CTCACAGCATTGAGCAACAAAGG - Intronic
1129414244 15:75366486-75366508 CTGACAGCACTGGTCAACCAGGG + Intronic
1130663860 15:85853092-85853114 CTGCCAACCTTCTTGAACAATGG - Intergenic
1133834131 16:9351345-9351367 CTACCACCATTGTTCAATCAAGG + Intergenic
1140159965 16:72479387-72479409 CTTCCAGCACTGTTAAATAAGGG - Intergenic
1149210395 17:54293856-54293878 CTGCCAACGTGGCTCAACAAAGG - Intergenic
1150152423 17:62821443-62821465 GTGCCAGCATTTTTCAACGCTGG - Intergenic
1150788558 17:68181850-68181872 CGGCCAGCATTTTTCAACAAGGG + Intergenic
1164197708 19:22985731-22985753 CTGCCAGCATTGCTCTAAATGGG - Intronic
1166395118 19:42433911-42433933 CTCCCAGCATTGTTCTACCTAGG + Intronic
931256131 2:60574715-60574737 CTGCCAGCATTGTTTTAATATGG + Intergenic
932960354 2:76406302-76406324 CTGCCAGCATTGGGCAGCATTGG + Intergenic
934587591 2:95516778-95516800 CTGGCAGCATTGTCCAGCAAAGG - Intergenic
934788469 2:97034727-97034749 CTGGCAGCATTGTCCAGCAAAGG - Intergenic
935333673 2:101995980-101996002 CTGGCAGCATGGATGAACAAGGG + Intronic
936373835 2:111924420-111924442 CTACCACCAGTGTTCCACAAAGG - Intronic
939566947 2:143796344-143796366 CTGGCAGCATTGGGCAAAAAAGG - Intergenic
942516570 2:176760024-176760046 CTGCAAGCTTTGTTCCAAAATGG - Intergenic
942807861 2:179955114-179955136 CTGCCTGCATTTTTAAATAAGGG + Intronic
944231715 2:197401436-197401458 CTGCCAGAAGTGTTTAAAAAAGG + Exonic
944796882 2:203196029-203196051 CTGCCATCATTGTTACAGAAAGG - Intronic
947203789 2:227641452-227641474 CTGCCAGTAATGTTCAGCCAAGG + Intergenic
948818345 2:240525421-240525443 CTGCCAGCACTGTGCAGGAAAGG - Intronic
1170342351 20:15343312-15343334 CTGCAAGCATTTTTCAAAGATGG + Intronic
1171907679 20:30912816-30912838 CGGCCAGCATAGTTTCACAATGG + Intergenic
1172180103 20:32997788-32997810 TTGCCAGCATTGTGCAACACTGG + Intronic
1175979227 20:62728658-62728680 GTGCCAGCATTGCTCAGGAAGGG + Intronic
1180341118 22:11618949-11618971 CGGCCAGCATAGTTTCACAATGG + Intergenic
949314678 3:2739266-2739288 CTACCAGCAGTGTTCAATCAAGG - Intronic
950647228 3:14384319-14384341 CTCACAGCCTTGTGCAACAAAGG - Intergenic
950739039 3:15034908-15034930 TTGCCAGCCTGGGTCAACAAAGG - Intronic
955083998 3:55684765-55684787 CTGTGAGAATTGTTCAAAAAAGG - Intronic
957590547 3:82191697-82191719 ATCCCAGCATTGTTTAACACAGG + Intergenic
958659499 3:97047923-97047945 GTTCCAGGATTGTTCAATAATGG + Intronic
959190686 3:103106709-103106731 CAGCCAGTATTGTTCAAATAAGG + Intergenic
962846619 3:139279350-139279372 CTGCCACCATGGTTCACCACTGG - Intronic
963297267 3:143559434-143559456 CTGCCAGCATTGTTGTAGAAAGG + Intronic
963923604 3:150928832-150928854 AAGACAGCATTGTTCAACTAAGG + Intronic
965110273 3:164412064-164412086 ATGCAAGCATGGTTCAACATAGG - Intergenic
968077770 3:195825698-195825720 CTGCCAGCGTCCTTCAACCATGG - Intergenic
970139971 4:12971433-12971455 CTACTACCATTGTTGAACAATGG + Intergenic
972033083 4:34487166-34487188 CTGCCTGCAATGTTAAACACAGG + Intergenic
973056319 4:45663856-45663878 CTCTCAGAATTGCTCAACAATGG - Intergenic
975407361 4:74005654-74005676 CTGCCCGCTTTGTTTAAAAAGGG + Intergenic
977169348 4:93741386-93741408 CTGCCAGCATACTTCAACAAGGG + Intronic
980136267 4:128861648-128861670 CTGCCATCATTGCTCTATAATGG + Intronic
980913138 4:139011270-139011292 CTGCCAGCAGTGTTGAAAATGGG - Intergenic
982251277 4:153409093-153409115 GTGCTAGCTTTGTTCAAGAAAGG + Intronic
982681636 4:158438209-158438231 CTGACAGACTTGCTCAACAAAGG - Intronic
983258590 4:165430824-165430846 GTGCCAGCATTCTTCAACCTTGG - Intronic
984816783 4:183845552-183845574 CTGGCAGCAGTTTTGAACAAGGG + Intergenic
988349310 5:30080894-30080916 CTACCATCATATTTCAACAAGGG - Intergenic
988466230 5:31495332-31495354 CTGCCAGCATTGTTGGTCATAGG + Exonic
990455781 5:55986185-55986207 CTTCTATCATTGTTCAAAAAGGG + Intronic
991096604 5:62746411-62746433 CTGCTATCAGTGCTCAACAATGG + Intergenic
993999958 5:94767099-94767121 ATGCAAGGATTGTTCAACATAGG + Intronic
994102116 5:95904800-95904822 CTGCTAGCAATGTTCAGGAAAGG + Intronic
996067279 5:119093086-119093108 CTGACAGATTTGCTCAACAAAGG - Intronic
996388974 5:122939475-122939497 CTGGAAGCATTTTTTAACAAGGG + Intronic
997502792 5:134390322-134390344 ATTCCAGCTTTGTTCAACAATGG - Exonic
1005143181 6:22657746-22657768 CTGCCATCCTTGGGCAACAAAGG + Intergenic
1007423196 6:41731939-41731961 CTGCCAGCATGGGTGACCAAAGG - Intronic
1013666803 6:112357805-112357827 CTGCCAGCATTATCAAAAAAAGG - Intergenic
1022311413 7:29200012-29200034 CTTCCACCATTGTGCAAAAATGG - Intronic
1026385512 7:69843474-69843496 ATGTCTGCATTGTTCAACACTGG + Intronic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1030654742 7:112154548-112154570 CTGCCATCCTGATTCAACAAGGG - Intronic
1032146312 7:129384702-129384724 CTGCCAGCTTTTCTCAACCAGGG + Intronic
1034548228 7:151802860-151802882 GTGCCAGCATTCCTCAAAAAAGG + Intronic
1034884983 7:154792547-154792569 CTGCCAGCAACATTCTACAAAGG - Intronic
1039032440 8:33324983-33325005 CTGCCAGTATTGTTGAAGGAAGG - Intergenic
1042098303 8:65243804-65243826 CTGCCAGCATTAAACAATAAGGG - Intergenic
1043039990 8:75251463-75251485 ATGCCAGGATGGTTCAACACAGG + Intergenic
1044185844 8:89251206-89251228 CTGCAAGCCTGGTTCAACATAGG - Intergenic
1046624209 8:116559913-116559935 CGCCCAGCCTTGTTCAACACTGG - Intergenic
1048366252 8:133741203-133741225 CTGCTAGGATTATTTAACAAAGG - Intergenic
1049186859 8:141259756-141259778 CTCCCAGCATCGGTCCACAATGG + Intronic
1061636162 9:131910133-131910155 CTACAAGCATTATTCAACCAGGG + Intronic
1196671040 X:118368571-118368593 CTCCCAGCAGTGTTTACCAAGGG + Intronic
1196736004 X:118981618-118981640 CTCCCAGCAGTGTTTACCAAGGG - Intronic
1198760587 X:140028389-140028411 GTCCCCGCAGTGTTCAACAAAGG + Intergenic
1200159625 X:153999578-153999600 CTCCCGGCATTGTTGAACACAGG - Intergenic